Unlock instant, AI-driven research and patent intelligence for your innovation.

Improved wheat shoot apex transformation method induced by agrobacterium

An Agrobacterium-mediated wheat technology, applied in the fields of plant genetic engineering and agricultural biology, can solve the problems of sterile plants, albino seedlings, and mutation of transformed plants, and achieve the effects of efficient acquisition, overcoming limitations, and eliminating influences.

Inactive Publication Date: 2005-07-06
SHANDONG UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These transformations all have successful examples, but they also have common and obvious shortcomings: first, the cultivation and regeneration of protoplasts are limited by genotype; second, the regeneration process of protoplasts often produces variation, and a high proportion of transformed plants is sterile albino seedlings
Although Woolston (1988), Dale (1989), Marks (1990), Chen and Dale (1992), Mahalakshmi and Khurana (1995) etc. all adopt 1 to 4 days seedling leaf base, dry seed growth point as the infection of Agrobacterium The explants of Agrobacterium achieved high-efficiency infection of Agrobacterium in vitro, but the target gene used was the complete sequence of barley yellow dwarf virus, and a small number of wheat somatic cells infected could synthesize complete barley yellow dwarf virus particles, which could further infect other plants. In wheat cells not infected by Agrobacterium, the target gene is not necessarily integrated into the wheat genome, but transiently expressed, the true transformation rate of Agrobacterium may be overestimated, and there is no molecular biological evidence of transgenic offspring in their articles It seems that this question can also be said

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved wheat shoot apex transformation method induced by agrobacterium
  • Improved wheat shoot apex transformation method induced by agrobacterium
  • Improved wheat shoot apex transformation method induced by agrobacterium

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0030] Example 1: Agrobacterium-mediated β-1,3 glucanase-chitinase gene seedling transformation of wheat to obtain transgenic offspring resistant to powdery mildew

[0031] 1. Transformation of shoot apex

[0032] Agrobacterium strain (EHA105 Agrobacterium strain, the plant bivalent expression vector of β-1,3 glucanase-chitinase gene contained therein, figure 1 ) was inoculated into 20 mL of YEP liquid medium containing 50 mg / L kanamycin + 50 mg / L rifampicin, cultured with shaking at 28°C and 170 r / min until the OD value was about 1.2, centrifuged at 10,000 r / min for 3 minutes, discarded Serum. The bacteria were resuspended in MB2 (Xue et al., 2004) liquid medium supplemented with 100 μmol / L AS, and diluted to an OD value of about 0.6.

[0033] Germinate wheat seeds at room temperature for 2-3 days after being sterilized with mercury chloride, and vernalize them at 4°C for 30 days. After the seedlings grow to 2-4 cm, use a clean blade to move downwards at a 45-degree angle a...

example 2

[0044] Example 2: Agrobacterium-mediated transformation of barley Mlo antisense gene into wheat to obtain offspring resistant to powdery mildew

[0045] 1. Isolation of barley Mlo gene

[0046] 1.1. Extraction of seedling RNA

[0047] 20 g of barley seedlings cultured under light at room temperature for seven days were taken, and total RNA was extracted by the one-step method reported by Pietro et al (2002).

[0048] 1.2. RT-PCR

[0049] Get 2ug of barley total RNA, use the RNA PCR Kit (AMV) Ver2.1 kit of Dalian Bao Biological Company, carry out reverse transcription and PCR reaction according to the manufacturer's requirements, PCR primers are designed according to the MLO gene sequence reported (Buschgas et al.1997 ). Primer I: GTGCATCTGCGTGTGCGTA; Primer II: CAGAAACTTGTCTCATCCCTG

[0050] 1.3 Cloning of PCR products

[0051] After pBSKS (1) plasmid DNA was digested with EcoRV, T-vector was prepared referring to the method reported by Woolston, C.J et al (1988). The ml...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an improved wheat shoot apex transformation method induced by agrobacterium which comprises, (1) subjecting the seeds to vernalization for 20-30 days at 4 deg. C after germination, (2) activating bacillus which contains destination genes, (3) cutting the seedling of suitable size, exposing or damaging growing point positions, (4) dropping the bacillus droplet containing the destination genes onto the seedling incision, (5) recovering seedling growth, transplanting into soil for cultivation, screening antibiotics to obtain transgene strains and filial generation, (6) identifying transgene strain and the filial generation.

Description

technical field [0001] The invention belongs to the fields of agricultural biotechnology and plant genetic engineering, and mainly relates to a method for transforming wheat shoot tips mediated by Agrobacterium and its application. Background technique [0002] Since the first transgenic tobacco was obtained in 1984 (Leone A et al, 1991), plant transgenic technology has been widely used, and it has special significance for molecular genetics research and plant improvement. [0003] Plant gene transformation methods mainly include direct gene transfer (Sato T et al, 1992) and Agrobacterium-mediated transformation (Finlay CA et al, 1989). Direct gene transfer mainly includes PEG-mediated transfer, electrical shock-mediated gene transfer and gene gun (Wates M M et al, 1995) transformation. These transformations all have successful examples, but they also have common and obvious shortcomings: first, the cultivation and regeneration of protoplasts are limited by genotype; second...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H1/00C12N15/84
Inventor 夏光敏陈惠民赵双宜赵庆臻刘恒赵同金
Owner SHANDONG UNIV