Improved wheat shoot apex transformation method induced by agrobacterium
An Agrobacterium-mediated wheat technology, applied in the fields of plant genetic engineering and agricultural biology, can solve the problems of sterile plants, albino seedlings, and mutation of transformed plants, and achieve the effects of efficient acquisition, overcoming limitations, and eliminating influences.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0030] Example 1: Agrobacterium-mediated β-1,3 glucanase-chitinase gene seedling transformation of wheat to obtain transgenic offspring resistant to powdery mildew
[0031] 1. Transformation of shoot apex
[0032] Agrobacterium strain (EHA105 Agrobacterium strain, the plant bivalent expression vector of β-1,3 glucanase-chitinase gene contained therein, figure 1 ) was inoculated into 20 mL of YEP liquid medium containing 50 mg / L kanamycin + 50 mg / L rifampicin, cultured with shaking at 28°C and 170 r / min until the OD value was about 1.2, centrifuged at 10,000 r / min for 3 minutes, discarded Serum. The bacteria were resuspended in MB2 (Xue et al., 2004) liquid medium supplemented with 100 μmol / L AS, and diluted to an OD value of about 0.6.
[0033] Germinate wheat seeds at room temperature for 2-3 days after being sterilized with mercury chloride, and vernalize them at 4°C for 30 days. After the seedlings grow to 2-4 cm, use a clean blade to move downwards at a 45-degree angle a...
example 2
[0044] Example 2: Agrobacterium-mediated transformation of barley Mlo antisense gene into wheat to obtain offspring resistant to powdery mildew
[0045] 1. Isolation of barley Mlo gene
[0046] 1.1. Extraction of seedling RNA
[0047] 20 g of barley seedlings cultured under light at room temperature for seven days were taken, and total RNA was extracted by the one-step method reported by Pietro et al (2002).
[0048] 1.2. RT-PCR
[0049] Get 2ug of barley total RNA, use the RNA PCR Kit (AMV) Ver2.1 kit of Dalian Bao Biological Company, carry out reverse transcription and PCR reaction according to the manufacturer's requirements, PCR primers are designed according to the MLO gene sequence reported (Buschgas et al.1997 ). Primer I: GTGCATCTGCGTGTGCGTA; Primer II: CAGAAACTTGTCTCATCCCTG
[0050] 1.3 Cloning of PCR products
[0051] After pBSKS (1) plasmid DNA was digested with EcoRV, T-vector was prepared referring to the method reported by Woolston, C.J et al (1988). The ml...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 