Supercharge Your Innovation With Domain-Expert AI Agents!

Epitope identification and modification for reduced allergenic activity in proteins targeted for transgenic expression

a technology of transgenic expression and protein, applied in the direction of magnoliophyta medical ingredients, plant/algae/fungi/lichens ingredients, peptides, etc., can solve the problems of affecting the quality of protein quality enhancement of native bnmrp, and reducing or negative allergenic activity

Inactive Publication Date: 2006-05-25
THE CHINESE UNIVERSITY OF HONG KONG
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0023] The IgE-binding activity, i.e. the allergenic activity of the modified protein according to the invention and a plant protein produced by the method of the invention can be significantly reduced or eliminated. Therefore, the target protein of the invention can be applied for human and livestock consumption.

Problems solved by technology

Most plant proteins, however, are nutritionally incomplete, due mainly to their deficient in certain essential amino acids.
It is well known that the seed protein of legumes is nutritionally incomplete, due to its deficiency in methionine, one of the essential amino acids of human and livestock.
Unfortunately, during the development of this potential improved product, the BNMRP was identified as a major allergen of the Brazil nut, designated Ber e 1, because it could be recognized by most of the sera from patients allergic to Brazil nut (Arshad S. H. et al., 1991; Asero R. et al., 2002; Bartolome B. et al., 1997; Oommen A. et al., 2000; Pastorello E. A. et al., 1998).
The potential risk of anaphylaxis hampers the use of native BNMRP for protein quality enhancement in transgenic crops, and further efforts in developing and marketing the methionine-enriched transgenic soybean was halted.
However, our knowledge of structural characteristics of conformational IgE binding sites is very limited (Baerga-Ortiz A., 2002; Bredehorst R. and David K., 2001; Bufe A., 2001; Gonzalez E. M. et al., 2002; Karisola P. et al., 2002; Sen M. et al., 2002).

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Epitope identification and modification for reduced allergenic activity in proteins targeted for transgenic expression
  • Epitope identification and modification for reduced allergenic activity in proteins targeted for transgenic expression
  • Epitope identification and modification for reduced allergenic activity in proteins targeted for transgenic expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

Construction of N-Terminal Deletions of BNMRP and Overlapping, Recombinant Peptides

Construction of Recombinant BNMRP Fragments

[0081] pHS-3 (Accession Number M17146, ARCO Plant Cell Research Institute, CA, USA), a plasmid containing a cDNA encoding the BNMRP (Altenbach S. B. et al., 1987), was used as a template for PCR cloning of recombinant BNMRP fragments. Gene-specific primers which were shown in Table 1, were designed with restriction enzyme sites for cloning into a pET-30a(+) expression vector (Novagen).

TABLE 1Primers Used for Fragmentation of BNMRPPosi-PrimersSequences (5′-3′)tions*BNLa5GCCAGATCTCCCAGGCGGGGAATG262-276BNLa3CGGACCTCGAGCTTCGCATCTGCAGCT325-339BNLb5GCCAGATCTGGCTTAAGGATGATG340-354BNLb3CGGACCTCGAGCCCTCATCATCCTTCG403-417BNLc5GCCAGATCTCTGGCCGAGAATATC418-432BNLc3CGGACCTCGAGCGAACCCGGCAATGGA478-492BNS5GCCAGATCACAGGAGGAGTGTCGC163-177BNS3CGGACCTCGAGCGCTCTCCTCCATCTG232-246Control 1-5CAGACCATGGCTCGAGGTCCGTGC—Control 1-3CCGGGAATTCAAACAGCCCTGCGTTATA—

*The position refers to...

example 2

Epitope Mapping of BNMRP

[0090] As shown schematically in FIG. 1, eight overlapping fragments covering the small and large subunits of the BNMRP were generated by PCR. To achieve efficient expression, the fragments were expressed in E. coli as fusion proteins with the E. coli thioredoxin (trxA) and flagellin (ηliC) of a pFlitrx vector. Expression levels were determined by Coomassie brilliant blue staining of proteins after separation by tricine SDS-PAGE. The induced proteins were purified and quantified (FIG. 1c). After separation by tricine SDS-PAGE, the fusion proteins were blotted onto nitrocellulose membrane and analyzed for binding with a rabbit anti-BNMRP serum and a pooled human serum from 9 patients allergic to Brazil nut. FIG. 1c showed clearly that IgG epitopes were mapped to the middle and C-terminal parts of the large subunit of BNMRP. No IgG reactivity was observed in the small subunit and the N-terminal part of the large subunit. Distribution of IgE epitopes on BNMRP s...

example 3

Identification of Key Amino Acids Critical to IgE Binding within Identified Epitopes

Modification of Epitopes by Alanine Substitution

[0101] Using the clones containing the native epitopes as templates, PCR was carried out using pƒu DNA polymerase by combination of the T7 promoter primer and a primer designed to introduce the mutation, as shown in Table 3. After digestion with Xba I, the PCR product was ligated with the Xba I / EcoR V backbone of the pET-32a(+) vector, forming the fusion protein containing the mutated epitope fused to the C-terminal of the trxA::His·tag.

[0102] The strong epitopes L6 and S1 and the two methionine-rich regions associated epitopes L3 and L4 were chosen to identify amino acids that are important for IgE binding in each of the epitopes. The native and mutated peptides were produced in E. coli as trxA fusion proteins. Expression was quantified by Coomassie brilliant blue staining of proteins after separation by tricine SDS-PAGE. The recombinant peptides w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Electrical conductanceaaaaaaaaaa
Volumeaaaaaaaaaa
Volumeaaaaaaaaaa
Login to View More

Abstract

Disclosed is a method for identification of key amino acids in plant proteins critical in generating allergenic activity through mapping the epitope(s) harboring human IgE binding activity. The identified epitope (s) are then modified by amino acid substitution preferably by alanine substitution, for reduced or negative IgE-binding activity. A plant gene expression system comprising a DNA construct placed operably under the control of a promoter sequence that confers seed-specific expression is also disclosed for the expression of the modified proteins. The Brazil nut 2S sulfur-rich protein was exemplified. The method disclosed herein is particularly useful for the production of dietary proteins with improved nutritional quality and reduced or negative allergenicity for human and animal consumption through genetic engineering.

Description

CROSS REFERENCE OF RELATED APPLICATIONS [0001] The present application claims the benefit of U.S. Provisional Application Ser. No. 60 / 559,732 filed on Apr. 6, 2004, entitled the same, which is explicitly incorporated herein by reference in its entirety.BACKGROUND OF THE INVENTION [0002] 1. Field of the Invention [0003] The present invention is directed to an application of an inventive systematic strategy for mapping, identification and thereby modification of identified allergenic epitope(s) in proteins with significant reduction or total elimination of human IgE-binding activity for transgenic expression. [0004] 2. Description of Prior Art [0005] Plants proteins are the primary source of dietary protein for human and livestock. Most plant proteins, however, are nutritionally incomplete, due mainly to their deficient in certain essential amino acids. Recent advances in plant biotechnology offer new approaches to enhance the protein quality (Sun S. S. M. and Larkin B. A., 1992). Alt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H1/00C07H21/04C12N15/82A61K36/18
CPCC07K14/415C12N15/8242C12N15/8251C12N15/8257
Inventor SUN, SAMUELCHEN, DAMING
Owner THE CHINESE UNIVERSITY OF HONG KONG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More