Check patentability & draft patents in minutes with Patsnap Eureka AI!

Expression of sucrose phosphorylase in plants

Inactive Publication Date: 2006-05-30
MONSANTO TECH LLC
View PDF12 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0002]Recent advances in genetic engineering have provided the requisite tools to transform plants to contain foreign genes. It is now possible to produce plants which have unique characteristics of agronomic and crop processing importance. Certainly, one such advantageous trait is enhanced starch and / or solids content and quality in various crop plants. Another is enhanced oil and protein content of seeds of various crop plants.

Problems solved by technology

It has also been found that its expression during certain phases of seed development can decrease the oil content which is thought to be due to the shunting of raw material to the starch pathway with a concomitant decrease in its availability for oil production.
Bruising can lead to loss of quality in the tuber, lower consumer acceptance of potatoes and potato products, and processing loss of tubers having excessive levels of bruising.
These longer cooking times may result in over-cooking of the higher solids strips.
In the manufacture of potato chips, slices are cut across the potato tuber and the non-uniform distribution of solids can result in a fried product with overcooked edges, under-cooked centers, and a higher fat content (especially in the center).
The non-uniform distribution of solids in the potato tuber also results in disproportionate losses of potato solids (from the cortex) during the peeling process.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression of sucrose phosphorylase in plants

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0063]A sucrose phosphorylase gene, gtfA, was generated by PCR amplification from Streptococcus mutans cells. The gene was amplified using the 5′ oligonucleotide:[0064]5CCCGGATCCATGGCAATTACAAATAAAAC (SEQ ID NO:1) and the 3′ oligonucleotide:[0065]5′GGGGAGCTCACTCGAAGCTTATTGTTTGATCATTTTCTG (SEQ ID NO:2)

[0066]The PCR cycling conditions were as follows: 94° C., 3′;55° C., 2′;72° C., 2′ (5 cycles);94° C. 1′;55° C. 2′;72° C. 2′ (30 cycles). The 1462 bp PCR product was purified using the GeneClean purification system (Bio101, Vista, Calif.), digested with BamHI and SacI, and ligated into the BamHI and SacI sites of pUC119. The ligated DNA was transformed into JM101 and a blue-white screen was used to identify colonies for plasmid preparation and restriction digestion. Digestion with HindIII was used to screen for transformants containing the gtfA gene. Clones with correct restriction patterns were screened for phenotypic expression by the ability to utilize sucrose as sole carbon source as ...

example 2

[0074]The vector pMON17357 was transformed into Russet Burbank potato callus following the method described by Barry et al. in WO 94 / 28149 for glyphosate selection of transformed lines. A number of lines were obtained and evaluated in field tests. The results of this test are shown in Table 1. As can be seen therein, several lines were identified as containing higher starch levels (measured as total solids) and some of those had decreased bruising.

[0075]

TABLE 1BruisingLineSolids (%)IndexIdentificationMeanMeanControl21.93.399 122.93.798 322.23.479 423.32.899 621.82.798 822.72.9791121.62.9681222.03.3831422.33.2181522.72.9791722.33.3941821.73.3941922.43.2132222.73.503

[0076]Tubers from twelve lines were tested for any change in the distribution of starch between the pith or cortex. This was accomplished by peeling the tubers, cutting them into strips resembling french fries, and measuring solids using a brine flotation comparison test. The average solids level for strips from the pith w...

example 3

[0080]Expression of gtfA in corn introduces a novel catalytic activity which may facilitate sucrose import into the endosperm by creating a steeper concentration gradient and conserve energy since the equivalent of one mole of ATP is normally required to convert sucrose to a hexose plus a hexose phosphate. The vector pMON24502 has been introduced into maize cells by microprojectile bombardment using two different types of embryogenic callus tissue for transformation. It was cotransformed with either (1) pMON19476 which contains a selection cassette of the enhanced 35S promoter, the Hsp 70 intron, the NPTII coding sequence for kanamycin resistance, and the nos 3′ sequence or (2) pMON19336 which contains two selection cassettes for glyphosate resistance, each using the rice actin promoter and the Hsp70 intron, but one uses a gene encoding glyphosate oxidase and one uses the CP4 glyphosate resistance gene.

[0081](1) Immature maize embryos (H99 genotype) were isolated as described in EP ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Volumeaaaaaaaaaa
Volumeaaaaaaaaaa
Volumeaaaaaaaaaa
Login to View More

Abstract

Introducing sucrose phosphorylase activity into plants by transformation with a gene for the enzyme increases the rate of sucrose hydrolysis, leading to increased starch, oil, and / protein levels. Sucrose phosphorylase genes from Streptococcus mutans and Leuconostoc mesenteroides have been found particularly advantageous for use in the present invention. Surprisingly, in potatoes transformed to express these genes in tubers, reduced bruise discoloration susceptibility and increased uniformity of starch deposition throughout the tuber are achieved.

Description

[0001]This application is a continuation-in-part of U.S. application Ser. No. 08 / 596,024 filed Feb. 6, 1996, now U.S. Pat. No. 5,716,837, which is a continuation-in-part of U.S. application Ser. No. 08 / 386,860 filed Feb. 10, 1995 now abandoned.[0002]Recent advances in genetic engineering have provided the requisite tools to transform plants to contain foreign genes. It is now possible to produce plants which have unique characteristics of agronomic and crop processing importance. Certainly, one such advantageous trait is enhanced starch and / or solids content and quality in various crop plants. Another is enhanced oil and protein content of seeds of various crop plants.[0003]Sucrose is the carbon storage unit which is transported from the source tissues of most plants to the sink tissues. In sink tissues it is hydrolyzed and the components used to build other, more complex storage units, primarily starch, protein, and oil. The hydrolysis is primarily accomplished by sucrose synthase ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/00A01H4/00C12N15/29C12N15/31C12N15/82A01H1/00C12N5/10C12N9/10C12N9/14C12N15/09C12N15/54C12R1/91
CPCC12N9/1051C12N15/8245Y02A40/146
Inventor BARRY, GERARD FRANCISDE WEERD, JAN WILLEMKISHORE, GANESH MURTHYWELDON, MARCIA LEE
Owner MONSANTO TECH LLC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More