Expression of sucrose phosphorylase in plants
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
[0063]A sucrose phosphorylase gene, gtfA, was generated by PCR amplification from Streptococcus mutans cells. The gene was amplified using the 5′ oligonucleotide:[0064]5CCCGGATCCATGGCAATTACAAATAAAAC (SEQ ID NO:1) and the 3′ oligonucleotide:[0065]5′GGGGAGCTCACTCGAAGCTTATTGTTTGATCATTTTCTG (SEQ ID NO:2)
[0066]The PCR cycling conditions were as follows: 94° C., 3′;55° C., 2′;72° C., 2′ (5 cycles);94° C. 1′;55° C. 2′;72° C. 2′ (30 cycles). The 1462 bp PCR product was purified using the GeneClean purification system (Bio101, Vista, Calif.), digested with BamHI and SacI, and ligated into the BamHI and SacI sites of pUC119. The ligated DNA was transformed into JM101 and a blue-white screen was used to identify colonies for plasmid preparation and restriction digestion. Digestion with HindIII was used to screen for transformants containing the gtfA gene. Clones with correct restriction patterns were screened for phenotypic expression by the ability to utilize sucrose as sole carbon source as ...
example 2
[0074]The vector pMON17357 was transformed into Russet Burbank potato callus following the method described by Barry et al. in WO 94 / 28149 for glyphosate selection of transformed lines. A number of lines were obtained and evaluated in field tests. The results of this test are shown in Table 1. As can be seen therein, several lines were identified as containing higher starch levels (measured as total solids) and some of those had decreased bruising.
[0075]
TABLE 1BruisingLineSolids (%)IndexIdentificationMeanMeanControl21.93.399 122.93.798 322.23.479 423.32.899 621.82.798 822.72.9791121.62.9681222.03.3831422.33.2181522.72.9791722.33.3941821.73.3941922.43.2132222.73.503
[0076]Tubers from twelve lines were tested for any change in the distribution of starch between the pith or cortex. This was accomplished by peeling the tubers, cutting them into strips resembling french fries, and measuring solids using a brine flotation comparison test. The average solids level for strips from the pith w...
example 3
[0080]Expression of gtfA in corn introduces a novel catalytic activity which may facilitate sucrose import into the endosperm by creating a steeper concentration gradient and conserve energy since the equivalent of one mole of ATP is normally required to convert sucrose to a hexose plus a hexose phosphate. The vector pMON24502 has been introduced into maize cells by microprojectile bombardment using two different types of embryogenic callus tissue for transformation. It was cotransformed with either (1) pMON19476 which contains a selection cassette of the enhanced 35S promoter, the Hsp 70 intron, the NPTII coding sequence for kanamycin resistance, and the nos 3′ sequence or (2) pMON19336 which contains two selection cassettes for glyphosate resistance, each using the rice actin promoter and the Hsp70 intron, but one uses a gene encoding glyphosate oxidase and one uses the CP4 glyphosate resistance gene.
[0081](1) Immature maize embryos (H99 genotype) were isolated as described in EP ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Volume | aaaaa | aaaaa |
| Volume | aaaaa | aaaaa |
| Volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

