Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Refractory metal prolease gene engineering bacterium and acquiring method therefor

A technology of metalloprotease and high temperature resistance, applied in genetic engineering, microorganism-based methods, plant gene improvement, etc., can solve the problems of low enzyme activity, unstable expression of high temperature resistance, unstable enzyme production, etc., and achieve easy purification Effect

Inactive Publication Date: 2008-02-06
THE INST OF MICROBIOLOGY XINJIANG ACADEMY OF AGRI SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Aiming at the characteristics of unstable enzyme production, low enzyme activity, and unstable expression of high temperature resistant metalloprotease strains at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Refractory metal prolease gene engineering bacterium and acquiring method therefor
  • Refractory metal prolease gene engineering bacterium and acquiring method therefor
  • Refractory metal prolease gene engineering bacterium and acquiring method therefor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1: Amplification and validation of Bacillus Licheniformis CGMCC NO0800 high-temperature metalloprotease.

[0071] By designing a pair of primer sequences: EMP1 ATA CGG GTG GTT GAC ACT

[0072] EMP2ACA TGA ATA TGG CTA GTT TGC

[0073] Using the chromosome of XJT9503 bacteria as a template, a 1005bp fragment EMP was amplified by PCR, and the PCR reaction was carried out in a 50μl system. Take 1 μl of DNA extracted by XJT9503 as a template, add 20 μl of sterilized deionized water, 25 μl of Taq enzyme mixed solution, EMP12 μl (25 pmol), EMP22 μl (25 pmol), and amplify the high-temperature neutral protease gene in a PCR automatic cycler, cycle parameters Denaturation at 94°C for 5 min, 94°C for 1 min, 55°C for 1 min, 72°C for 2 min, 30 cycles, and finally 72°C for 10 min. After the cycle, take 5 μl of the PCR product for 1% agarose gel electrophoresis, ethyl bromide After ingot staining, observe under ultraviolet light and analyze PCR products, see Figure 1.

[00...

Embodiment 2

[0085] Embodiment 2: Transformation of high temperature resistant metalloprotease gene

[0086] According to the codon preference of yeast, the obtained genes were analyzed and the codons encoding some amino acids were found to have low expression or even zero expression. Three pairs of primers were designed to perform site-directed mutagenesis on these codons to transform the gene, see Figure 5, Figure 6; Refer to Figure 7 for the transformation plan.

[0087] P1: GCACGAATTCATACGGGTGGTTGACACT

[0088] P2: TGTAGTACGGTAGCCGTACCAG

[0089] P3: GGCTACCGTACTACAAACAGCAGC

[0090] P4: GTTACGATAAACAGGCGAGCCGCTTTG

[0091] P5: CCTGTTTATCGTAACTACAGTGATACAGG

[0092] P6: GTACGCGGCCGCACATGAATATGGCATGTTTGC

[0093] Use primers P1, P3 paired, P4, P5 paired, P6, P2 paired with plasmid pMD18-TE as a template for PCR, denaturation at 94°C for 5min, 94°C for 1min, 55°C for 1min, 72°C for 2min, and the number of cycles is 30 , recover the above-mentioned three-stage PCR product, and then ...

Embodiment 3

[0094] Example 3: Construction of Yeast Expression Vector and Acquisition of Genetically Engineered Bacteria Containing Thermostable Metalloprotease Gene

[0095] The modified gene was digested with EcorI and NotI and connected with the yeast expression vector pPIC9K vector with EcorI and NotI to construct vector 9TE. After identification, the sequencing results proved that the gene transformation was successful and the reading frame was correct, see Figure 8 and Figure 9.

[0096] The constructed yeast expression vector, SacI linearized CIAP dephosphorylated, electrotransformed protease-deficient yeast strain SMD1168, the transformation method is as follows:

[0097] 1. Take a single colony of SMD1168 in 5ml YPD culture medium, shake overnight at 30°C, take 20ul of the cultured bacteria into 100ml YPD culture medium, culture at 30°C until the cell density reaches 1-2A OD 600 . According to the formula 12A OD600=5×10 7 cell / ml Count cells.

[0098] 2. Collect the cells in 8...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses (pichia pastoris) CGMCC No1622, which can produce metal protease and a manufacturing method of obtaining the bacterial strain. Through designing a DNA primer, 1005 basic group is obtained by using PCR method and increasing from the total DNA of the Bacillus licheniformis XJT9503, and then cloned on the Pmd18-T carrier, after making a sequence analysis and measure to the obtained gene, the high temperature neutral protease gene is EMP, the snatch size is 942 basic group which expresses 314 aminophenol, and a Bacillus subtilis system is made use of validating and affirming the obtained gene. The present invention provides an effective way for making the extensive ferment and production and improving the output of enzyme.

Description

field of invention [0001] The invention relates to the field of microorganisms and microbial fermentation. Specifically, the present invention relates to a high-temperature resistant metalloprotease genetically engineered bacterium and its obtaining method. Background technique [0002] Metalloproteases are a class of neutral proteases whose active centers are metal ions. As a large class of biological enzymes, proteases are widely used in food, medicine, detergent, textile and leather processing, etc. High-temperature protease has the characteristics and advantages of fast catalytic reaction speed, no industrial pollution, and wide adaptability to catalytic reaction conditions, especially in heat resistance, denaturant resistance, organic solvent resistance, etc., and has important application value. Not only that, the elucidation of the heat-resistant mechanism of high-temperature proteases can also provide a theoretical basis for people to transform natural enzymes by p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/57C12N15/81C12N9/60C12R1/84
Inventor 王玮张志东冯怀蓉张涛谢玉清张伟茆军唐琦勇马东林闫论
Owner THE INST OF MICROBIOLOGY XINJIANG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com