Cell model for sifting anti-diabetic drugs

A cell model and anti-diabetic technology, applied in the field of genetic engineering, can solve the problems of cumbersome operation, high cost, and difficulty in high-throughput screening, and achieve the effects of high accuracy, low cost, and simple and controllable preparation methods

Inactive Publication Date: 2008-06-18
XIHUA UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods are expensive, cumbersome to operate, and difficult to achieve high-throughput screening. There is an urgent need to establish new screening methods in this field.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell model for sifting anti-diabetic drugs
  • Cell model for sifting anti-diabetic drugs
  • Cell model for sifting anti-diabetic drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] The selection of embodiment one insulin receptor (IR) gene expression vector

[0044] IR is a transmembrane receptor located on the cell membrane and is an important signaling pathway. Mutations in structural genes or during expression can lead to insulin resistance, leading to the occurrence of type II diabetes. IR is a heterotetrameric protein that is widely distributed in the cell membranes of various tissues throughout the body. Each cell has about 1,000 to 300,000 receptors, including two extracellular α subunits and two transmembrane β subunits. When insulin Upon binding to the α subunit of IR, the tyrosine kinase activity of the β subunit is activated. Extensive studies have shown that the ability of IR to autophosphorylate and phosphorylate intracellular substrates is critical for mediating complex cellular responses to insulin.

[0045] In the present invention, the plasmid pCMV-hIR cloned with human IR cDNA sequence is used, and the preparation method uses t...

Embodiment 2

[0046] The selection of embodiment two expression vectors STAT5b gene expression vector

[0047] STAT5b is the latest identified insulin receptor substrate (IRS). It interacts with the tyrosine of the β subunit of IR through its SH2 sequence, and STAT5b can be phosphorylated by the active domain of the purified insulin receptor tyrosine kinase (IRTK). Insulin can activate IRTK activity by stimulating IR phosphorylation, thereby activating the tyrosine phosphorylation of endogenous STAT5b in cells. Unlike other IRSs that have been discovered, STAT5b is a transcriptional activator. The activated STAT5b binds to the regulatory sequence of target genes with STAT5 response elements in the nucleus, thereby activating the transcription and expression of target genes. Therefore, the STAT5B target-controlled reporter gene can be used to detect IRTK activity, avoiding the laborious and costly receptor isolation procedure in traditional assay methods, thus potentially achieving high-thr...

Embodiment 3

[0049] Example 3 Expression vector pSTAT5b 3 - Establishment of TK-LUC

[0050] Among the various reporter genes available in the field, luciferase (LUC) has the characteristics of high sensitivity, convenient detection and easy quantification. One example of the present invention is based on the plasmid pTK-LUC expressing LUC. Insert an artificially synthesized DNA fragment (SEQ ID NO.3) containing three tandem STAT5B response elements at the upstream of its promoter with NheI / EcoRI endonuclease site:

[0051] 5'-GCG GCTAGC TGTGTGGACTTCTTGGAATTAAGGGACTTT

[0052] TGTGTGGACTTCTTGGAATTAAGGGACTTT

[0053] TGTGTGGACTTCTTGGAATTAAGGGACTTT

[0054] TGGGATCCGGCCCCGCCCAGCGTCTTGTCATTGGC GAATTC GCG-3'

[0055] Wherein TGTGGACTTCTTGGAATTAAGGGACTTT (SEQ ID NO.4) is a STAT5B response element, GCTAGC , GAATTC Respectively NheI and EcoRI restriction site.

[0056] Transfer the above sequence into pTK-LUC to obtain pSTAT5B 3 -TK-LUC. A small amount of recombinant plasmid DNA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a cell model for sieving diabetes resistant medicine and a preparation method thereof. A technical problem for solving is to provide a medicine sieving cell model which is provided with definite medicine effect mechanism and direct, prompt, simple and convenient medicine filtration and is fit for high-throughput medicine sieving and a corresponding sieving method. The cell model of the present invention is mammalian cell which clones the coding sequence of IR gene, the coding sequence of STAT5B gene and the coding sequence of reporter gene which is regulated by STAT5B responsive element. The present invention can indirectly monitor IRTK activity by inspecting reporter gene expression level in the cell model to exactly sieve the diabetes resistant medicine with the high-throughput of the cell level.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a cell model capable of screening antidiabetic drugs. Background technique [0002] Drug screening model is an experimental method used to prove that a certain substance has pharmacological activity (biological activity, therapeutic effect), and is one of the important conditions for finding and discovering new drugs. The drug screening model at the molecular and cellular levels has the characteristics of less material consumption, clear drug mechanism of action, and high-throughput screening. It has become the main method of drug screening at present. [0003] Diabetes is a systemic metabolic disorder characterized by "three excesses and one deficiency". It is estimated that there are 130 million diabetic patients in the world at present, and the demand for antidiabetic drugs is very urgent. However, the drugs currently used for the treatment of type II diabetes all have cer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/16C12Q1/68G01N33/68
Inventor 陈祥贵杨潇戴清源
Owner XIHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap