Amalgamation protein of human glucagons-like peptide-1and uses thereof

A glucagon and fusion protein technology, which is applied to the fusion protein of human glucagon-like peptide-1 analogues and its application field, can solve the problems of difficult polypeptide technology, high production cost, environmental pollution, etc., and achieve Solve the effects of short half-life, low production cost and easy availability of raw materials

Inactive Publication Date: 2008-07-16
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these drugs are all chemically synthesized, and chemically synthesized peptides are often technically difficult, high in production costs, difficult to purify, and cause environmental pollution. Their immunogenicity, stability, and safety are still under further investigation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amalgamation protein of human glucagons-like peptide-1and uses thereof
  • Amalgamation protein of human glucagons-like peptide-1and uses thereof
  • Amalgamation protein of human glucagons-like peptide-1and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Synthetic Pro237 gene sequence

[0063] According to the sequence: Pro237 gene-stop codon TAG, chemically synthesized base sequence with a length of 513bp, as follows:

[0064] BamHI

[0065] 5'- ggactt ATGAAACGTCATAGTGAAGGGGCCTTTACCAGTGAT

[0066] Met Lys Arg His Ser Glu Gly Thr Phe Thr Ser Asp

[0067] GTGAGTTCTTACTTGGAGGGCCAGGCAGCAAAGGAATTCATT

[0068] Val Ser Ser Tyr Leu Glu Gly Gln Ala Ala Lys Glu Phe Ile

[0069] GCTTGGCTGCTGAAAGGCCGAGGAAGGCGACATGCTGATGGA

[0070] Ala Trp Leu Val Lys Gly Arg Gly Arg Arg His Ala Asp Gly

[0071] TGCTTCTCTGATGATATGAACACGATTCTCGATAACCTTGCCGCC

[0072] Ser Phe Ser Asp Glu Met Asn Thr Ile Leu Asp Asn Leu Ala Ala

[0073] AGAGACTTCATCAACTGGCTGATTCAAACCAAGATTCACTGAC

[0074] Arg Asp Phe Ile Asn Trp Leu Ile Gln Thr Lys Ile Thr Asp

[0075] AAGAAACATAGTGAAGGGGCCTTTACCAGTGATGTGAGTTCT

[0076] Lys Lys His Ser Glu Gly Thr Phe Thr Ser Asp Val Ser Ser

[0077] TACTTGGAGGGCCAGGCAGCAAAGGAATTCATTGCTTGGCTG

[0078] Tyr Leu Gl...

Embodiment 2

[0096] Example 2 Transform Escherichia coli with an expression vector containing the Pro237 gene sequence to obtain a genetically engineered strain

[0097] Transform the constructed recombinant plasmid pET32a-Pro237 into competent Escherichia coli BL21(DE3), keep it in an ice bath for 30 minutes, raise the temperature to 42°C in a water bath for 90 seconds, then quickly transfer it to an ice bath, cool for 2-3 minutes, and transfer to the transformation mixture Add 500 μl of LB culture solution to the medium, mix well, and shake culture at 37°C (<180rpm, 30min), take 200μl and transfer to LB agar culture plate containing Amp, cultivate overnight at 37°C, and screen out Amp-resistant monoclonal colonies. The positive clones were identified by BamHI and HindIII double restriction digestion and agarose gel electrophoresis, and DNA sequencing was performed on the region between the recombinant plasmid BamHI and HindIII double restriction restriction sites to confirm the geneticall...

Embodiment 3

[0100] Example 3 Inducing Genetically Engineered Bacteria to Express Fusion Protein Pro237

[0101] The recombinant plasmid pET32a-Pro237 was extracted and further transformed into Escherichia coli BL21(DE3) to construct the genetic engineering expression bacteria. Pick a single colony and inoculate it in 5 ml of LB medium containing 100 μg / ml Amp, and cultivate overnight at 37° C. with shaking at 180 rpm. Take 50 μl of the overnight culture and transfer it to 5ml LB medium, culture it at 37°C, 210rpm until the logarithmic growth phase, measure its OD 600 When = 0.5-0.6, add IPTG with a final concentration of 0.1-1 mM to induce expression for 2-4 hours, produce and accumulate soluble expressed Pro237 fusion protein, centrifuge, discard the supernatant, and collect wet cells. (See Figure 4, Figure 5)

[0102] Figure 4 is the SDS-PAGE electrophoresis results of the protein expressed by the fusion protein Pro237 induced by IPTG. In the figure, 1 is the low molecular weight pro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion protein of a human glucagon-like peptide -1(hGLP-1) analogues and the preparation method for the fusion protein, wherein, the fusion protein is a pro-drug with high biological stability and long half-life in vivo that releases active GLP-1 molecule after being degraded by enzyme in vivo and then brings into playing the pharmacological action. The scope of the invention extends to the treatment application of the products made by the production technique. The fusion protein can be used for treating and preventing the diseases or disorders relating the GLP-1 activity, in particular to the 2 Diabetes Mellitus. The fusion protein of a human glucagon-like peptide -1(hGLP-1) analogues and the preparation method for the fusion protein relates to the biotechnological field, with the fusion protein prepared by the gene engineering method, which has the advantages of much lower production cost than the chemical synthetic method, simple operation, and easy acquisition of raw material, and has possibility for commercial production.

Description

technical field [0001] The present invention relates to recombinant protein and its therapeutic application, in particular to the fusion of human glucagon-like peptide-1 (hGLP-1) and its analogs with human glucagon-like peptide-2 (hGLP-2) at the gene level Expressed recombinant protein in the form of prodrug, and the application of such fusion protein in preventing or treating diseases or disorders related to GLP-1 activity, especially type 2 diabetes and its complications. Background technique [0002] Diabetes is a worldwide common and frequently-occurring disease, which seriously endangers human health. In 2007, the latest data released by the International Diabetes Federation (IDF) showed that 246 million people in the world are currently suffering from diabetes, and the total number of diabetic patients will exceed 380 million in the next 20 years. Among existing patients, more than 85% are type 2 diabetes mellitus, that is, non-insulin-dependent diabetes mellitus (NID...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/435C12N15/70A61K38/17A61P3/10A61P3/04
Inventor罗晓星惠宏襄马雪
OwnerFOURTH MILITARY MEDICAL UNIVERSITY