Recombined bifidobacteria -hRV/VP7 expression vector and oral administration vaccine thereof

A bifidobacteria and expression vector technology, applied in the field of genetic engineering, to achieve the effects of broad clinical application prospects, high safety and high safety

Inactive Publication Date: 2008-07-16
CHONGQING MEDICAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Currently, there are only reports on the use of bifidobacteria as a gene transfer system for gene therapy of human solid tumors [9] , but the use of bifidobacteria for the preparation of recombinant RV virus protein live vaccines has not been reported at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined bifidobacteria -hRV/VP7 expression vector and oral administration vaccine thereof
  • Recombined bifidobacteria -hRV/VP7 expression vector and oral administration vaccine thereof
  • Recombined bifidobacteria -hRV/VP7 expression vector and oral administration vaccine thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of Bifidobacterium-Escherichia coli shuttle expression vector of the present invention

[0035] 1. Replace the Ptac promoter (183932) on pGEX-5x-1 with the promoter AmyO (position: 599-690nt) of the α-amylase (amylase) gene (GenBank No: AY240946) of bifidobacteria, and simultaneously use PCR Methods The LacIq fragment (position: 3301-4420nt) on pGEX-5x-1 was deleted.

[0036] Specific steps are as follows:

[0037] 1. Use BamHI and SacII enzymes to cut 110 base pairs of the α-amylase gene AmyO (promoter) sequence synthesized by Shanghai Bioengineering Technology Co., Ltd., and add the M13 reverse sequencing primer sequence (taaaacgacggccagt) to its 5' end ( SEQ ID NO.4) for sequencing.

[0038] Its construction route is as follows:

[0039] (1) Promoter sequence of bifidobacterium α-amylase gene: 599 ta aaataaacag catacgttcgcaatagtgca aacgctatca aagaagatga acccccgtta aagggattga agaaaaggaa taaaggagcc690 (SEQ ID NO.5)

[0040] (2) gtaaaacgacgg...

Embodiment 2

[0063] Example 2 Construction of pBEX-hRV / VP7 expression vector (see attached for a schematic diagram of the construction process Figure 4 )

[0064] Construction of pBEX-hRV / VP7:

[0065] 1, amplify viral protein VP7 gene (GENBANK NO.M21843, VP7, hRV Wa strain, coding region: 49...1029 from the genome of hRVWa strain by RT-PCR method, the VP7 gene used among the present invention is as SEQ shown in ID NO.2).

[0066] Primers are:

[0067] VP7F: atcggatccatgtatggtattgaatatac (SEQ ID NO. 13) (BamHI site added).

[0068] VP7R: acggtcgacctatacctctataataaaaagctg (SEQ ID NO. 14) (SalI site added).

[0069] The method is: take 10 μl of the extracted RNA, heat at 100°C for 2 minutes to denature the double-stranded RNA, and then centrifuge briefly after 2 minutes on ice, then add 4 μl of 5×AMV Bufer, 2 μl of dNTPs, 1 μl of downstream primer (30 μM / μl), RNasin 1μl, reverse transcriptase AMV 2μl, add ddH20 to make up the 25μl reaction system. Reverse transcription at 42°C for 1 h...

Embodiment 3

[0074] Embodiment three The preparation of the bifidobacterium seed bacteria containing pBEX-hRV / VP7 recombinant vector of the present invention

[0075] 1. Screen the bifidobacteria with an OD value of 0.6 as the recipient bacteria. After being treated with sterilized 10% glycerol prepared in deionized water, the pBEX-hRV / VP7 recombinant plasmid vector prepared in Example 2 is transformed into the recipient bacteria by electroporation. In body bacteria. The conversion conditions are: 15KV, 200Ω, 25μF.

[0076] 2. Resuscitate the transformed bifidobacteria in MRS liquid medium without antibiotics for 60-120 minutes, and then culture them on MRS solid medium containing 50 μg / ml ampicillin to select resistant colonies to obtain transformed ETEC For the bifidobacterium with CFA / I gene, the positive clone identified by PCR and SDS-PAGE is the bifidobacterium seed fungus containing the pBEX-hRV / VP7 recombinant vector.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant bifidobacterium hRV-VP7 expression vector and the oral vaccine. The invention pertains to the field of genetic engineering. The technical problem to be solved is to construct a new bifidobacterium expression vector of hRV virus VP7 protein. The recombinant bifidobacterium hRV-VP7 expression vector of the invention is loaded with a virus protein VP7 coding gene sequence of a human group A rotavirus. The expression vector of the invention can be transfected into the bifidobacterium and can be further prepared into an hRV / VP7 transgenic bifidobacterium-hRV-VP7 recombinant vector oral live vaccine preparation after fermentation culture. The invention is mainly used for the prevention and adjuvant treatment of infantile diarrhea which is caused by human rotavirus, thus having great market prospect.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a recombinant bifidobacterium hRV-VP7 expression vector and an oral vaccine thereof. Background technique [0002] Human group A rotavirus (human rotavirus, hRV) is the main pathogen that causes severe diarrhea in newborns. About 60% of severe diarrhea is caused by RV. About 500,000 infants and young children in the world die every year due to RV infection. Therefore, WHO prioritizes RV vaccine research [1] . [0003] At present, the direction of global RV vaccine research is mainly artificially reassorted attenuated oral live vaccines, the most influential of which is the oral vaccine produced by Wyeth-Ayerst Company, but it will soon withdraw from the market due to safety problems (the trade name is Rotashield?, Voluntarily withdrawn in June 1999 due to intussusception in the recipient [1] ). RIX4414 in the past two years [12-13] and RotaTeq [14] Phase 3 cli...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/74C12N15/46C12N1/21A61K48/00A61K39/15A61K39/02A61K39/39A61K9/08A61K9/20A61K9/48A61P31/14C12R1/01
Inventor马永平宋方洲
OwnerCHONGQING MEDICAL UNIVERSITY