Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for detecting encephalitis virus IgM antibody colloidal gold, method for making same and applications

A JE virus and detection test strip technology, applied in the field of JE virus IgM antibody colloidal gold detection test strips, can solve the problems of unsuitable clinical diagnosis routine use, complicated operation, time-consuming and other problems, to save manpower and material resources, and to achieve clear results Easy-to-distinguish, easy-to-operate effects

Active Publication Date: 2009-02-11
辽宁迪浩生物科技有限公司
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The neutralization test has high specificity and sensitivity, but the operation is complicated and requires a large number of animals or tissue culture tubes, which takes a long time and is not suitable for routine use in clinical diagnosis, but is valuable in serological epidemiological investigation and virus identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for detecting encephalitis virus IgM antibody colloidal gold, method for making same and applications
  • Test paper strip for detecting encephalitis virus IgM antibody colloidal gold, method for making same and applications
  • Test paper strip for detecting encephalitis virus IgM antibody colloidal gold, method for making same and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Preparation of Japanese Encephalitis Virus E Gene Antigen Domain III

[0035] (1) Obtaining the target gene

[0036] According to the sequence of the target gene fragment and the characteristics of the pGEX-4T-1 expression vector, design primers containing restriction enzymes BamH1 and HindIII restriction sites at both ends:

[0037] 5'TAAGGATCCCACCTGAAATGTAGGCTG3'

[0038] 5'CGGGAAGCTTGAAGACCCCTCCAATAGA3'

[0039] The total viral RNA was extracted by conventional methods, and then RT-PCR was performed immediately, and the reverse transcription product was identified and recovered by 1% agarose gel electrophoresis.

[0040] (2) Cloning of the target gene and screening of positive recombinants

[0041] Ligate the recovered PCR amplification product with the PMD-18T cloning carrier overnight at 16°C, transform into DH5a competent cells, pick a monoclonal strain, culture overnight at 37°C, extract the plasmid, and use the plasmid as a template to carry out PCR...

Embodiment 2

[0049] Example 2 Japanese encephalitis virus IgM antibody colloidal gold rapid detection test strip (see Figure 1)

[0050] (1) Preparation of colloidal gold-antibody conjugates:

[0051] It has been determined by experiments that the optimal binding pH of the colloidal label of anti-human IgM monoclonal antibody is 8.0, and the ratio of colloidal gold and antibody is 18 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (containing 0.5% BSA, pH 8.0, 0.01MTris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on the glass fiber, and freeze-dry , and stored in a dry environment.

[0052] (2) Coating antigen on nitrocellulose membrane:

[0053] The Japanese encephalitis virus E gene antigenic domain III protein was diluted to 3.2±0.1mg / ml with 0.01MPBS. The anti-mouse IgG polyclonal antibody was diluted to 2±0.1 mg / ml with 0.01 MPBS. Spray the two on the nitrocellulose memb...

Embodiment 3

[0060] Embodiment 3 detection method (see figure 2 )

[0061] 100-150 μl of the patient's whole blood, plasma or serum specimen is directly dropped into the "4" of the test strip of Example 2, the sample solution runs up the membrane, and the result is interpreted within 10-15 minutes.

[0062] result:

[0063] If the test sample contains JE virus IgM antibody, it will form a corresponding complex with the colloidal gold-labeled anti-human IgM monoclonal antibody on the test strip, and bind to the JE virus-specific antigen coated on the nitrocellulose membrane in the upstream direction. , forming a red line, that is, a red band at T.

[0064] Regardless of whether the specimen contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgM monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is formed at "C". This line is a quality control line. If the coll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a test strip for rapid detection of Japanese encephalitis virus IgM antibody. A Japanese encephalitis virus E gene antigen domain III and a double-antibody IgM III coat a nitrate cellulose film (NC film), and a membrane chromatography indirect sandwich method is adopted to detect the Japanese encephalitis virus specific IgM antibody in an infected human body specimen in combination with a colloidal gold labeled antihuman IgM monoclonal antibody. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base course, site detection and epidemiological investigation, and has auxiliary effect on the diagnosis of Japanese encephalitis virus infection.

Description

technical field [0001] The invention relates to a Japanese encephalitis virus IgM antibody colloidal gold detection test strip, a preparation method and application thereof, and belongs to the field of biological detection. Background technique [0002] Japanese encephalitis (JE), referred to as JE, is an infectious disease of the central nervous system caused by neurotropic JE virus (JEV) [1]. It is spherical, with a diameter of 20-30nm. The core contains single-stranded RNA, has a capsid, and has three structural proteins, namely E protein, nucleoprotein C and membrane protein M.E protein is a glycoprotein, wrapped on the surface of the virus, which determines the virus Its virulence and its host range not only play an important role in binding to host cell receptors and subsequent membrane fusion, but also stimulate the production of neutralizing antibodies and play a major role in immune protection. It is typically characterized by febrile headache followed by a series ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/577G01N33/576G01N33/558G01N33/545
Inventor 刘明
Owner 辽宁迪浩生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com