Dioxin detection apparatus and detection method
A detection method and detection device technology, applied in the field of dioxin detection and electrochemical dioxin detection device, can solve the problems of insufficient system sensitivity, difficulty in product commercialization, expensive and complex detection mode of gold electrode electrochemical instrument, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Preparation of Aryl Hydrocarbon Acceptor
[0048] The culture medium and buffer used in this embodiment are as follows:
[0049] (1) Medium used for protein expression, LB medium, Ampicillin (Amp) (final concentration 100 μg / ml), chloramphenicol (Cm) (final concentration 34 μg / ml).
[0050] (2) LB medium: tryptone (Tryptone) 10g / L, yeast extract 5g / L, NaCl 10g / L.
[0051] (3) GST washing / binding buffer: 140mM NaCl, 10mMNa 2 HPO 4 , 1.8mM KH 2 PO 4 , 2.7mM KCl, 0.1mM PMSF, pH 7.3.
[0052] (4) GST elution buffer: 50 mM Tris-HCl, 10 mM reduced glutathione (glutathione), 0.1 mM PMSF, pH 8.0.
[0053] 5) 6X Loading buffer: 300 mM Tris-HCl, pH 6.8, 12% SDS, 0.6% Bromophenol blue, 60% glycerol, 6% β-mercaptoethanol.
[0054] (6) SDS-PAGE electrophoresis buffer (Running buffer): 25 mM Tris-HCl, pH 8.3, 250 mM glycine, 0.1% SDS.
[0055] (7) Aryl hydrocarbon receptor storage buffer: 50 mM Tris-HCl, pH 7.4, 500 mM NaCl, 1 mM DTT, 0.1% NP-40, 0.1 mM PMSF.
[00...
Embodiment 2
[0064] Example 2 Preparation of Aryl Hydrocarbon Receptor Nuclear Translocation Protein
[0065] This implementation was carried out with the medium and buffer used in Example 1.
[0066] (a) Cloning the DNA of the aryl hydrocarbon receptor nuclear translocation protein and the aryl hydrocarbon receptor binding region into the vector pGEX-4T1
[0067] According to the NCBI website ( http: / / www.ncbi.nlm.nih.gov / index. html) to design primers for the ligand-binding fragment of the aryl hydrocarbon receptor nuclear translocator protein disclosed in the literature on mouse liver aryl hydrocarbon receptor nuclear translocator gene mRNA. The primers were designed as follows: Forward primer (Forword primer): 5'GGAACTGGCAACACATCTACT3', located at nucleotide 486-506 of the gene sequence, reverse primer (Reverseprimer): 5'TGTAGGCCGTGGTTCCTGGCT3', located at 1458th nucleotide of the gene sequence Nucleotide-1478 nucleotides, then using the total mouse liver RNA as a template, use reve...
Embodiment 3
[0074] Example 3 Preparation of detection device test piece
[0075] In this embodiment, a screen printing electrode (SPE; purchased from Taibo (Qiaoying) Technology Co., Ltd.) is used to prepare the detection device of the present invention. The structure of the detection device 100 is as shown in Figure 1, including a PVC material substrate 102; A reference electrode 104, which is located on the substrate 102; a working electrode 106, which is located on the substrate 102 and not in contact with the reference electrode 104; a working area 108, which is located on the working electrode 106; and a PVC insulation Layer 110. The base material of the screen printing electrode is made of PVC, and the screen printing carbon glue is divided into three procedures. First, the silver glue is applied to the area other than the working area 108, and then the first and second layers of the working area 108 are screened with pure carbon glue. The third layer is printed with an appropriate...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap