Plant expression vector of arabidopsis glutathione dependent formaldehyde dehydrogenase gene, construction method and application thereof
A technology of plant expression vector and formaldehyde dehydrogenase, which is applied in the field of plant genetic engineering, can solve the problems of inability to deal with the hazards of high-concentration formaldehyde and low expression level, so as to improve the ability and efficiency of plants to absorb and tolerate exogenous formaldehyde Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1: FALDH gene cDNA amplification and TA cloning
[0043] First search the full-length gene sequence of adh from GenBank, and design a pair of primers, the sequence is as follows:
[0044] 5'adh: CA CCATGG CGACTCAAGGTCAGGTTATC
[0045] 3'adh: GAATTC TCATTTGCTGGTATCGAGG
[0046] The CACC characteristic sequence was added to the 5'adh end of the upstream primer, thereby forming an NcoI restriction site; the 3'adh end of the downstream primer was added with an EcoR I restriction site.
[0047] Use TRIzoL Reagent (Invitrogen) to extract total RNA from Arabidopsis thaliana seedlings, take about 0.1 g of young leaves of the plant, add 1 ml of TRIzoL extract, grind in a mortar, let stand at room temperature for 5 minutes, transfer to a centrifuge tube, and then Add 0.2ml of chloroform, shake and mix, centrifuge for 15min (12000rpm), transfer the supernatant to a new tube, add 0.5ml of isopropanol, mix and place at room temperature for 10min, centrifuge at 4°C fo...
Embodiment 2
[0049] Example 2: Construction of intermediate vector pENTR TM -adh
[0050] Digest pMD-adh and pENTR with Sal I and EcoR I TM 2B-ccdB( image 3 ), the cut vector and the insert fragment were separated by agarose gel electrophoresis, and the adh gene fragment (1.1kb) and pENTR generated after pMD-adh was cut were recovered respectively TM The vector fragment pENTR produced after 2B-ccdB is cut TM 2B, then connect pENTR with the ligase kit of TaKaRa TM The DNA fragment of 2B and adh gene produces the intermediate vector pENTR TM -adh( image 3 ). Conversion of high efficiency (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), and cultivate overnight at 37 ° C. Screen the Km-resistant recombinant colony, extract the plasmid from the Km-resistant recombinant colony, and select the successfully connected plasmid vector pENTR TM -ad...
Embodiment 3
[0051] Embodiment 3: Construction of entry clone pENTR*-PrbcS-adh
[0052] Digest pENTR with Nco I and EcoR I TM -adh and pENTR*-PrbcS-*T-GFP plasmids ( Figure 5 ), separated the cut vector and insert fragment by agarose gel electrophoresis, and recovered the vector fragment pENTR*-PrbcS (4.0kb) and pENTR generated after pENTR*-PrbcS-*T-GFP was cut from the gel TM The DNA fragment (1.1kb) of the adh gene generated by cutting -adh, and then use the ligase kit of TaKaRa to connect the DNA fragment of pENTR*-PrbcS and adh gene to generate the entry vector pENTR*-PrbcS-adh( Figure 5 ). Conversion of high efficiency (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), and cultivate overnight at 37 ° C. Screen the Km-resistant recombinant colony, extract the plasmid from the Km-resistant recombinant colony, select the successfully connect...
PUM
Property | Measurement | Unit |
---|---|---|
absorption wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com