Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant expression vector of arabidopsis glutathione dependent formaldehyde dehydrogenase gene, construction method and application thereof

A technology of plant expression vector and formaldehyde dehydrogenase, which is applied in the field of plant genetic engineering, can solve the problems of inability to deal with the hazards of high-concentration formaldehyde and low expression level, so as to improve the ability and efficiency of plants to absorb and tolerate exogenous formaldehyde Effect

Inactive Publication Date: 2009-11-04
KUNMING UNIV OF SCI & TECH
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Higher plants all have a formaldehyde dissimilation pathway, but the expression level of the key enzyme FALDH in this pathway is low in higher plants, which cannot cope with the harm of high concentrations of formaldehyde in the external environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression vector of arabidopsis glutathione dependent formaldehyde dehydrogenase gene, construction method and application thereof
  • Plant expression vector of arabidopsis glutathione dependent formaldehyde dehydrogenase gene, construction method and application thereof
  • Plant expression vector of arabidopsis glutathione dependent formaldehyde dehydrogenase gene, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: FALDH gene cDNA amplification and TA cloning

[0043] First search the full-length gene sequence of adh from GenBank, and design a pair of primers, the sequence is as follows:

[0044] 5'adh: CA CCATGG CGACTCAAGGTCAGGTTATC

[0045] 3'adh: GAATTC TCATTTGCTGGTATCGAGG

[0046] The CACC characteristic sequence was added to the 5'adh end of the upstream primer, thereby forming an NcoI restriction site; the 3'adh end of the downstream primer was added with an EcoR I restriction site.

[0047] Use TRIzoL Reagent (Invitrogen) to extract total RNA from Arabidopsis thaliana seedlings, take about 0.1 g of young leaves of the plant, add 1 ml of TRIzoL extract, grind in a mortar, let stand at room temperature for 5 minutes, transfer to a centrifuge tube, and then Add 0.2ml of chloroform, shake and mix, centrifuge for 15min (12000rpm), transfer the supernatant to a new tube, add 0.5ml of isopropanol, mix and place at room temperature for 10min, centrifuge at 4°C fo...

Embodiment 2

[0049] Example 2: Construction of intermediate vector pENTR TM -adh

[0050] Digest pMD-adh and pENTR with Sal I and EcoR I TM 2B-ccdB( image 3 ), the cut vector and the insert fragment were separated by agarose gel electrophoresis, and the adh gene fragment (1.1kb) and pENTR generated after pMD-adh was cut were recovered respectively TM The vector fragment pENTR produced after 2B-ccdB is cut TM 2B, then connect pENTR with the ligase kit of TaKaRa TM The DNA fragment of 2B and adh gene produces the intermediate vector pENTR TM -adh( image 3 ). Conversion of high efficiency (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), and cultivate overnight at 37 ° C. Screen the Km-resistant recombinant colony, extract the plasmid from the Km-resistant recombinant colony, and select the successfully connected plasmid vector pENTR TM -ad...

Embodiment 3

[0051] Embodiment 3: Construction of entry clone pENTR*-PrbcS-adh

[0052] Digest pENTR with Nco I and EcoR I TM -adh and pENTR*-PrbcS-*T-GFP plasmids ( Figure 5 ), separated the cut vector and insert fragment by agarose gel electrophoresis, and recovered the vector fragment pENTR*-PrbcS (4.0kb) and pENTR generated after pENTR*-PrbcS-*T-GFP was cut from the gel TM The DNA fragment (1.1kb) of the adh gene generated by cutting -adh, and then use the ligase kit of TaKaRa to connect the DNA fragment of pENTR*-PrbcS and adh gene to generate the entry vector pENTR*-PrbcS-adh( Figure 5 ). Conversion of high efficiency (10 8 ) Escherichia coli competent cells (DH5α, purchased from Tiangen Biochemical Technology Co., Ltd.), spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), and cultivate overnight at 37 ° C. Screen the Km-resistant recombinant colony, extract the plasmid from the Km-resistant recombinant colony, select the successfully connect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
absorption wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention relates to a plant expression vector pH2-35S-PrbcS-adh of arabidopsis glutathione-dependent formaldehyde dehydrogenase gene, which is the plant expression vector of light-induced promoter (PrbcS) containing tomato Rubisco 3C small subunit gene and the arabidopsis glutathione-dependent formaldehyde dehydrogenase (FALDH) gene adh. The gene adh is amplified from arabidopsis, and the over expression of the gene adh in tobacco lamina cytoplasm is controlled by the light-induced promoter, so that the efficiency of decomposing formaldehyde by tobacco cell can be improved, thus enhancing the capability of absorbing and enduring exogenous formaldehyde by plant. The experiment proves that enzyme activity of adh transgenic tobacco FALDH is increased by about 3-5 times compared with that of wild type; after being cultured for 30 days on an MS solid culture medium containing 10mmol / L of formaldehyde, the growing situation of the adh transgenic tobacco is obviously superior to that of wild type. In addition, when 2mM formaldehyde liquid is used for treating the plant, the formaldehyde absorption rate of the adh transgenic tobacco is obviously higher than that of wild type.

Description

Technical field: [0001] The invention belongs to the field of plant genetic engineering, and specifically relates to a plant expression vector pH2-35S-PrbcS-adh for improving the ability of plants to absorb and tolerate formaldehyde, and its construction method and application. Background technique: [0002] Formaldehyde is a colorless gas with a strong pungent odor, easily soluble in water, alcohol and ether. It has a strong reaction ability and can produce non-specific reactions with proteins, nucleic acids and lipids (Feldman et al., Prog Nucleic AcidRes Mol Biol, 1973, 13: 1-49). Biologically, they are highly toxic. Formaldehyde is widely used in industrial production as a raw material for the manufacture of resins, adhesives, paints, plastics, and man-made fibers, and is the most widely used chemical raw material in the adhesive industry. With the development of the economy and the improvement of people's living standards, building decoration materials made of various...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82
Inventor 陈丽梅宋中邦李昆志马莉胡清泉陈红梅
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com