Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mutated housefly acetylcholinesterase gene and expression thereof

A housefly acetyl and cholinesterase technology, applied in genetic engineering, plant genetic improvement, hydrolase and other directions, can solve the problems affecting the repeatability of test results, poor purity and stability, lack of sensitivity to pesticides, etc., and achieve large-scale applications. Value, Ease of Purification, Significant Sensitivity Effects

Inactive Publication Date: 2010-05-26
SHANGHAI ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are mainly two types of enzyme raw materials currently used: one is the pure enzyme preparation of acetylcholinesterase imported from abroad, such as the enzyme derived from electric eel and bovine serum, but the price is relatively high, and it lacks sensitivity to organophosphorus and carbamate pesticides; The second is to directly extract the crude enzyme solution from the insect body, but the purity and stability of this type of enzyme product are poor, which affects the repeatability of the test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutated housefly acetylcholinesterase gene and expression thereof
  • Mutated housefly acetylcholinesterase gene and expression thereof
  • Mutated housefly acetylcholinesterase gene and expression thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Acquisition of the Acetylcholinesterase (AChE) Gene Sequence of Musca domestica

[0033] The total RNA of the housefly was extracted, and the first strand of the total cDNA of the housefly was obtained by reverse transcription. Then use the forward primer Ace-F: 5'AAA GGATCC (BamH I) ATGGCTAGATCCGTCAG-3' and reverse primer Ace-R: 5'-AAA GAGCTC (Sac I) TTACTGGAAGATAGAG-3' was amplified by PCR to obtain the cDNA amplification product of the housefly AChE gene, which was recovered by electrophoresis. The recovered PCR product and pBbluScipt SK+ vector were double-digested with restriction endonucleases BamHI and Sac I respectively, and the digested fragments were connected to transform Escherichia coli (Escherichia coli) DH5α to obtain Escherichia coli containing AChE cDNA gene sequence Cloning, the plasmid containing the AChE cDNA sequence in Escherichia coli was named PBSK-AChE.

Embodiment 2

[0035] Mutations in the Musca domestica acetylcholinesterase (AChE) gene

[0036] According to the relationship between protein structure and function, the structure of AChE protein was simulated and analyzed, and finally the site-directed mutation transformation of the following amino acids was determined:

[0037] For the 180th amino acid mutation, the following primers were designed:

[0038] P180V-up: 5'- GT CGGTGCTTTCGGTTTCCTGCATC-3'

[0039] mutation site

[0040] P180V-dn: 5'-TCTGTACTGGAACGAGGCAACGATC-3'

[0041] For the 327th amino acid mutation, the following primers were designed respectively:

[0042] Y327D-up: 5'- GA TCCCTCGGCTCCAACCATCGAT-3'

[0043] mutation site

[0044] Y327D-dn: 5'ACTTAAAATTCCAGAATACGAGTTC3'

[0045] For the 374th amino acid mutation, the following primers were designed:

[0046] I374D-up: 5'- GA TGATTATTTCGATAAGGATGATG-3'

[0047] mutation site

[0048] I374D-dn: 5'AAAGTCGTAGAGCAGAAAATATGTGC3'

[0049] The above sites were seq...

Embodiment 3

[0051] Construction of Expression Vector of Acetylcholinesterase (AChE) Gene in Musca domestica

[0052] According to the multiple cloning site of the zymogen expression vector pPIC9K (purchased from Invitrogen), a pair of primers P1: 5'AAAAGAATTC (EcoRI) ATGACAGATCATCTAACGGTTC3' and P2: 5'AAAAGCGGCCGC (NotI)TTACTGGAAGATAGAGTTGAC3' were designed and synthesized at the 5' end The enzyme cutting sites EcoR I and Not I were introduced respectively. Using the plasmid containing the AChE gene as a template for PCR amplification, the amplified product was double-digested with EcoR I and Not I, and the digested product was connected with the vector pPIC9K after the same double-digestion, and transformed into E. coli competent cells. Pick positive clones for enzyme digestion identification and sequencing, figure 2 It is the enzyme digestion identification diagram of the recombinant expression plasmid. The constructed vectors were named pPIC9K-AChE and pPIC9K-VDD (mutation sites are...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutated housefly acetylcholinesterase gene and expression thereof. The gene is obtained by performing fixed point mutation of amino acid on the 180, 327 and 374 locuses of amino acid sequence SEQ ID NO.1 of housefly acetylcholinesterase gene at present. The amino acid sequence of the protein coded by the gene is shown as SEQ ID NO.3, the nucleotide sequence thereof is shown as SEQ ID NO.4, and the gene can be expressed fast and efficiently in a yeast expression system. The mutated housefly acetylcholinesterase gene in the invention has obvious sensibility to low concentration pesticides organophosphorus and carbamic acid ester, can be used for detecting pesticide residue in agricultural products, provides more sensitive protein material for developing pesticide biological detection products, and has large application value.

Description

technical field [0001] The invention belongs to the field of genetic bioengineering, in particular to a mutant housefly acetylcholinesterase gene and its expression. Background technique [0002] Acetylcholinesterase (AChE) mainly exists in the interneurons of multicellular animals and in the chemical synapses between neurons and muscle cells. It is a key enzyme in biological nerve transmission and a major signal transmission molecule. Acetylcholinesterase AChE performs the function of hydrolyzing the neurotransmitter acetylcholine Ach, thereby terminating the excitatory effect of Ach on cholinergic receptors and maintaining the sensitivity of nerve impulse transmission. [0003] Studies have shown that a variety of compounds can inhibit the activity of AChE, resulting in excessive choline-like metabolic pathways in organisms, choline esters cannot be effectively hydrolyzed, and accumulate in large amounts at nerve endings, and organisms show symptoms such as muscle twitchin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N15/63C12N9/18C12N15/81C12Q1/46C12R1/84
Inventor 唐雪明谭芙蓉赵凯王金斌吴潇朱宏陶世如蒋玲曦王利刚刘华
Owner SHANGHAI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com