Mutated housefly acetylcholinesterase gene and expression thereof
A housefly acetyl and cholinesterase technology, applied in genetic engineering, plant genetic improvement, hydrolase and other directions, can solve the problems affecting the repeatability of test results, poor purity and stability, lack of sensitivity to pesticides, etc., and achieve large-scale applications. Value, Ease of Purification, Significant Sensitivity Effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Acquisition of the Acetylcholinesterase (AChE) Gene Sequence of Musca domestica
[0033] The total RNA of the housefly was extracted, and the first strand of the total cDNA of the housefly was obtained by reverse transcription. Then use the forward primer Ace-F: 5'AAA GGATCC (BamH I) ATGGCTAGATCCGTCAG-3' and reverse primer Ace-R: 5'-AAA GAGCTC (Sac I) TTACTGGAAGATAGAG-3' was amplified by PCR to obtain the cDNA amplification product of the housefly AChE gene, which was recovered by electrophoresis. The recovered PCR product and pBbluScipt SK+ vector were double-digested with restriction endonucleases BamHI and Sac I respectively, and the digested fragments were connected to transform Escherichia coli (Escherichia coli) DH5α to obtain Escherichia coli containing AChE cDNA gene sequence Cloning, the plasmid containing the AChE cDNA sequence in Escherichia coli was named PBSK-AChE.
Embodiment 2
[0035] Mutations in the Musca domestica acetylcholinesterase (AChE) gene
[0036] According to the relationship between protein structure and function, the structure of AChE protein was simulated and analyzed, and finally the site-directed mutation transformation of the following amino acids was determined:
[0037] For the 180th amino acid mutation, the following primers were designed:
[0038] P180V-up: 5'- GT CGGTGCTTTCGGTTTCCTGCATC-3'
[0039] mutation site
[0040] P180V-dn: 5'-TCTGTACTGGAACGAGGCAACGATC-3'
[0041] For the 327th amino acid mutation, the following primers were designed respectively:
[0042] Y327D-up: 5'- GA TCCCTCGGCTCCAACCATCGAT-3'
[0043] mutation site
[0044] Y327D-dn: 5'ACTTAAAATTCCAGAATACGAGTTC3'
[0045] For the 374th amino acid mutation, the following primers were designed:
[0046] I374D-up: 5'- GA TGATTATTTCGATAAGGATGATG-3'
[0047] mutation site
[0048] I374D-dn: 5'AAAGTCGTAGAGCAGAAAATATGTGC3'
[0049] The above sites were seq...
Embodiment 3
[0051] Construction of Expression Vector of Acetylcholinesterase (AChE) Gene in Musca domestica
[0052] According to the multiple cloning site of the zymogen expression vector pPIC9K (purchased from Invitrogen), a pair of primers P1: 5'AAAAGAATTC (EcoRI) ATGACAGATCATCTAACGGTTC3' and P2: 5'AAAAGCGGCCGC (NotI)TTACTGGAAGATAGAGTTGAC3' were designed and synthesized at the 5' end The enzyme cutting sites EcoR I and Not I were introduced respectively. Using the plasmid containing the AChE gene as a template for PCR amplification, the amplified product was double-digested with EcoR I and Not I, and the digested product was connected with the vector pPIC9K after the same double-digestion, and transformed into E. coli competent cells. Pick positive clones for enzyme digestion identification and sequencing, figure 2 It is the enzyme digestion identification diagram of the recombinant expression plasmid. The constructed vectors were named pPIC9K-AChE and pPIC9K-VDD (mutation sites are...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
