Prokaryotic expression vector of Pseudomonas putida glutathione-independent formaldehyde dehydrogenase and construction method and application thereof

A Pseudomonas putida, prokaryotic expression technology, applied in the field of microbial genetic engineering, can solve problems that have not been reported yet

Inactive Publication Date: 2010-10-20
KUNMING UNIV OF SCI & TECH
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Rapid production and purification of active PADH protein with lower cost and simple method is a necessary condition for its wide application. PADH protein-specific antibody is an effective tool for detecting the expression level of PADH protein in plants. The preparation of its antibody is now There are studies that have not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prokaryotic expression vector of Pseudomonas putida glutathione-independent formaldehyde dehydrogenase and construction method and application thereof
  • Prokaryotic expression vector of Pseudomonas putida glutathione-independent formaldehyde dehydrogenase and construction method and application thereof
  • Prokaryotic expression vector of Pseudomonas putida glutathione-independent formaldehyde dehydrogenase and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: Preparation and detection of Pseudomonas putida genomic DNA:

[0042] The Pseudomonas putida used in the present invention was purchased from China Industrial Microorganism Culture Collection Center, and the genome DNA of Pseudomonas putida was prepared by using a common bacterial genome extraction method. Centrifuge 2 mL of the overnight culture at 4000 rpm for 2 min at 4°C, discard the supernatant, and collect the cells; add 100 µl of Solution I; 30 µl of 10% SDS, 1 µl of 20 mg / mL proteinase K, mix well, and incubate at 37°C for 1 hour; Add 100 μl 5mol / L NaCl, mix well; add 20 μl CTAB / NaCl solution (CTAB 10%, NaCl0.7mol / L), mix well, 65°C, 10 minutes; add an equal volume of phenol / chloroform / isoamyl alcohol mixture ( Phenol / chloroform / isoamyl alcohol (25:24:1) and mix well; centrifuge at 12000rpm for 5 minutes; take the supernatant, add 2 times the volume of absolute ethanol, 0.1 times the volume of 3mol / LNaOAC, and place it at -20°C for 30 minutes; cent...

Embodiment 2

[0043] Embodiment 2: Amplification and TA cloning of PADH gene:

[0044] ADH gene amplification and TA cloning strategies such as figure 2 As shown, firstly search the full-length gene sequence of PADH from GenBank (the GenBank accession number of ADH gene is D21201), and design a pair of primers, the sequence is as follows:

[0045] PADH5: CATATGTCTGGTAATCGTGGTGTCG

[0046] PADH3: CTCGAGGGCCGCGCTGAAGGTCTTGTG

[0047] The 5' end primer has a CATATG characteristic sequence, which forms an Nde I restriction site; the 3' primer end adds a CTCGAG characteristic sequence to the 3' end, thereby forming an Xho I restriction site.

[0048] Add 10ng of Pseudomonas putida genomic DNA as a template in the PCR reaction mixture, add 50ng of specific primers PADH5 and PADH3, 1.8 μl of NTP (10mM), 12.5 μl of 2×GCBuffer I and 0.4 μl of Taq plus ( 2.5U / μl) polymerase (Tiangen Biochemical Technology Co., Ltd.), and double distilled water was added to make the final reaction volume 20 μl. H...

Embodiment 3

[0049] Embodiment 3: Construction of prokaryotic expression vector pET28a-PADH:

[0050] The construction strategy of pET28a-PADH is as follows Figure 4 As shown, the purified prokaryotic expression plasmid vectors pET28a (purchased from Novagen) and pMD18-PADH were cut with NdeI (Fermentas) and XhoI (Fermentas), and the cut vectors and inserts were separated by agarose gel electrophoresis. The vector fragment pET28a (5.3kb) generated after pET28a was cut and the DNA fragment (1.2kb) of the PADH gene generated by cutting pMD18-PADH were recovered from the gel, and then the pET28a vector was ligated with the ligase kit of TaKaRa Fragmentation and DNA fragmentation of the PADH gene to generate the prokaryotic expression vector pET28a-PADH. Use the ligation reaction mixture to transform high-efficiency (108) Escherichia coli competent cells (DH5α, Tiangen Biochemical Technology), and spread the transformed Escherichia coli on a plate added with kanamycin (Km, 50 μg / ml), Cultiv...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a prokaryotic expression vector pET28a-PADH for efficiently expressing Pseudomonas putida glutathione-independent formaldehyde dehydrogenase protein. The vector is a prokaryotic expression vector containing a Pseudomonas putida glutathione-independent formaldehyde dehydrogenase gene (PADH). In the invention, the PADH gene is cloned from Pseudomonas putida, and the expression of the PADH gene in colon bacillus is controlled by using a T7 promoter; 40 percent of expressed recombinant protein exists in a supernate in a soluble mode (accounting for 30 percent of soluble total protein of the colon bacillus), and 60 percent of expressed recombinant protein exists in an inclusion body; the high-purity PADH recombinant protein can be easily obtained from the upper inclusion body through tapping and purification and can be used as an antigen used for preparing a PADH specific antibody. The PADH recombinant protein with activity can be easily purified from the soluble total protein of the colon bacillus by affinity chromatography and is used for the production and the physiological-biochemical characteristic analysis of PADH enzyme preparations.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, in particular to a prokaryotic expression vector pET28a-PADH for efficiently expressing glutathione-independent formaldehyde dehydrogenase protein (PADH) and its prokaryotic expression in PADH protein and preparation of PADH recombinant protein in the application. Background technique [0002] Formaldehyde exists widely in nature and is mainly produced through the degradation process of compounds containing methyl or methoxy groups such as lignin and pectin. Formaldehyde is also the main raw material used to manufacture resins, adhesives, paints, plastics, and man-made fibers in industrial production. Free formaldehyde in indoor air mainly comes from building materials, furniture, various adhesives and synthetic fabrics, etc. Since formaldehyde exists inside the board, the volatilization period can be as long as 3 to 15 years, and it is difficult to completely volatilize within one o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/53C12N9/02
Inventor陈丽梅张婧孟庆超年洪娟李昆志
OwnerKUNMING UNIV OF SCI & TECH