Enterorrhagia colibacillus stx1 gene detection kit and application method thereof
A technology for detection of Escherichia coli and genes, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, measurement/inspection of microorganisms, etc., and can solve problems such as long detection period, high cost of fluorescent probes, and complicated procedures
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] The preparation of embodiment 1 kit
[0084] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0085] Outer primer F3(1): (SEQ ID NO 1)
[0086] GTAGATTCGCTGAATGTCATT
[0087] Outer primer B3 (1): (SEQ ID NO 2)
[0088] TGTTAACAAATCCTGTCACAT
[0089] Internal primer FIP (1): (SEQ ID NO 3)
[0090] TCAATCATCAGTAAAGACGTACCCTCTTTTCGCTCTGCAATAGGTACT
[0091] Internal primer BIP (1): (SEQ ID NO 4)
[0092] CAGGGGATAATTTGTTTGCAGTTGATTTTCGTTCAACAATAAGCCGTAGA.
[0093] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;
[0094] (3) Prepare reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 1.2 μmol / L of inner primer FIP / BIP and each 0.2 μmol / L of outer primer F3 / B3 are placed in the container;
[0095] (4) Prepare the sample pretrea...
Embodiment 2
[0106] The preparation of embodiment 2 kit
[0107] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0108] Outer primer F3 (2): (SEQ ID NO 5)
[0109] TGCAGGGATCAGTCGTAC
[0110] Outer primer B3 (2): (SEQ ID NO 6)
[0111] AGATCATCCAGTGTTGTACG
[0112] Internal primer FIP (2): (SEQ ID NO 7)
[0113] GTCAGTGAGGTTCCACTATGCGTTTTAATCGCCATTCGTTGACTAC
[0114] Internal primer BIP (2): (SEQ ID NO 8)
[0115] TCTGTGGCAAGAGCGATGTTTTTCCCCTCTGTATTTGCCGAA.
[0116] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;
[0117] (3) Prepare reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1 volume % TritonX-100, 0.8mol / L betaine, each 2.0 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, put in the container;
[0118] (4) Prepare the sample pretreatment solution: the sam...
Embodiment 3
[0124] Example 3 Application of Enterohemorrhagic Escherichia coli stx1 Gene Detection Kit
[0125] 1 Materials and methods
[0126] 1.1 Materials
[0127] 1.1.1 Strains
[0128] There are 25 bacterial strains used in the present invention, mainly from Guangzhou Entry-Exit Inspection and Quarantine Bureau, clinical isolated bacterial strains and environmental isolated bacterial strains. See Table 1 for details.
[0129] Table 1 Names and sources of strains
[0130] strain source Strain and serial number Guangzhou CIQ Enterohemorrhagic Escherichia coli Clinical isolates 17 strains of enterohaemorrhagic Escherichia coli from the test samples; other strains 1 strain each of Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Salmonella, Listeria monocytogenes, Yersinia enterocolitica, and beta-hemolytic streptococcus.
[0131] 1.1.2 Main instruments and reagents
[0132] 1.2 Identification of isolated strains
[0133] 1.2.1 Culti...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com