Thrombolysis protease gene NKS1 and purpose thereof
A protease and gene technology, applied in the fields of molecular biology and genetic engineering, can solve problems such as unreported, and achieve the effect of high enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0044] Example 1. Cloning of Bacillus subtilis nattokinase gene NKS1
[0045] Genomic DNA extraction: Take 100ml of Bacillus subtilis cultured overnight, collect the bacteria by centrifugation at 4 ℃, extract high molecular weight genomic DNA, and obtain DNA with a molecular weight greater than 50kb, A260 / A280 = 1.80, the purity and molecular weight of the obtained DNA are suitable for PCR reaction.
[0046] PCR amplification and sequence analysis of the target gene: use genomic DNA as a template for PCR amplification (5' primer: 5'CGCTGAATTCATGGCGCAATCTGTTCTT3', 3'primer: 5'AGGCGTCGACTTATTGTGCAGCTGCTTG3'), after 30 cycles, use 1% of the PCR product Agarose gel electrophoresis showed an obvious specific amplification band at 825bp. The recombinant plasmid was used as a template for sequencing. The results showed that the cloned nattokinase gene coding region contains 825 bp nucleotides and correctly encodes 275 amino acids, which is exactly the same as the nattokinase mature pepti...
Example Embodiment
[0047] Example 2. DNA shuffling of NKS1 gene
[0048] 1) Preparation of starting material: Using pUC19-NK as a template, NK was amplified by PCR with Taq DNA polymerase, and purified as the starting material for DNA shuffling.
[0049] 2) Random digestion with DNase I: Take about 10 micrograms of purified NK and add to 50 microliters of digestion reaction system (10mM Tris-HCl pH7.4, 50mM MnCl2), 15℃, 10min. Add 0.15U DNase Ⅰ, mix well, 15℃, 2min, 90℃, 10min. The product is electrophoresed on 2.5% agarose gel, and the gel containing 100-200bp fragment is cut out and recovered.
[0050] 3) Primerless PCR: Take about 1 microgram of recovered small fragments and add them to a 50 microliter reaction system (10×Pfu buffer, 0.2mM each dNTP, 0.6U / microliter Pfu polymerase). The PCR program is the reaction conditions: pre-denaturation at 94°C for 60s, denaturation at 94°C for 30s, annealing at 50°C for 30s, extension at 72°C for 30s, a total of 40 cycles, and finally extension at 72°C for 5...
Example Embodiment
[0053] Example 3. Construction of expression shuffling library
[0054] Recombinant expression vector construction: Cut the NKS1 gene from the pUC19 plasmid containing the NKS1 gene, mix it with the pET23a plasmid after the same enzyme digestion at a ratio of 2:1, add T4DNA ligase to ligate at 22 ℃ for 4 hours, the ligation solution transforms the competent E1coli DH5α cells were screened for positive recombinants, and their plasmids were extracted and identified by restriction enzyme digestion with EcoRIPSal I.
[0055] Activate the constructed engineering bacteria, transfer to fresh LB medium with 2% inoculum on the next day, cultivate at 30°C to A600 = 0.8~1.0, add IPTG to a final concentration of 1mM, and continue to cultivate for 4h. The cells were collected by centrifugation, 10 times volume of PBS was added, the wall was broken by ultrasonic for 30 minutes, and the supernatant was collected by centrifugation at 4°C for 10 minutes. The supernatant was collected and analyzed b...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap