Thrombolysis protease gene NKS1 and purpose thereof

A protease and gene technology, applied in the fields of molecular biology and genetic engineering, can solve problems such as unreported, and achieve the effect of high enzyme activity

Inactive Publication Date: 2012-02-01
南京百吉生物科技有限公司
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But application of this technology aspect improving the performance of nattokinase gene and its protein, all there is no report both at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thrombolysis protease gene NKS1 and purpose thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1. Cloning of Bacillus subtilis nattokinase gene NKS1

[0045] Genomic DNA extraction: Take 100ml of overnight cultured Bacillus subtilis, collect the bacteria by centrifugation at 4 ℃, extract high molecular weight genomic DNA, and obtain DNA with a molecular weight greater than 50kb, A260 / A280 = 1.80, the purity and molecular weight of the obtained DNA are suitable for PCR reaction.

[0046] PCR amplification and sequence analysis of the target gene: PCR amplification was performed using genomic DNA as a template (5′ primer: 5′CGCTGAATTCATGGCGCAATCTGTTCTT3′, 3′ primer: 5′AGGCGTCGACTTATTGTGCAGCTGCTTG3′), after 30 cycles, the PCR product was washed with 1% Agarose gel electrophoresis showed an obvious specific amplification band at 825bp. Sequencing was performed using the recombinant plasmid as a template, and the results showed that the cloned nattokinase gene coding region contained 825 bp nucleotides, correctly encoded 275 amino acids, and was identical to ...

Embodiment 2

[0047] Example 2. DNA shuffling of the NKS1 gene

[0048] 1) Preparation of starting materials: Using pUC19-NK as a template, NK was amplified by PCR with Taq DNA polymerase, and purified as starting materials for DNA shuffling.

[0049] 2) Random digestion with DNase I: Take about 10 micrograms of purified NK and add it to 50 microliters of enzyme digestion reaction system (10mM Tris-HCl pH7.4, 50mM MnCl2), 15°C, 10min. Add 0.15U DNase I, mix well, 15°C, 2min, 90°C, 10min. The product is electrophoresed through 2.5% agarose gel, and the gel containing 100-200bp fragments is excised and recovered.

[0050] 3) PCR without primers: Take about 1 microgram of the recovered small fragments and add them to a 50 microliter reaction system (10×Pfu buffer, 0.2mM each dNTP, 0.6U / microliter Pfu polymerase). The PCR program is reaction conditions: pre-denaturation at 94°C for 60s, denaturation at 94°C for 30s, annealing at 50°C for 30s, extension at 72°C for 30s, a total of 40 cycles, an...

Embodiment 3

[0053] Example 3. Construction of expression shuffling library

[0054] Construction of recombinant expression vector: cut NKS1 gene from the pUC19 plasmid containing NKS1 gene, mix it with the pET23a plasmid that has undergone the same enzyme digestion at a ratio of 2:1, add T4 DNA ligase at 22 ℃ for 4 hours, and transform the competent E1coli DH5α cells, screening positive recombinants, extracting their plasmids, and using EcoRIPSal I enzyme digestion identification.

[0055] Activate the constructed engineering bacteria, transfer to fresh LB medium with 2% inoculum the next day, cultivate at 30°C until A600 = 0.8-1.0, add IPTG to a final concentration of 1mM, and continue to cultivate for 4h. The cells were collected by centrifugation, 10 times the volume of PBS was added, the wall was broken by ultrasonic for 30 minutes, and the supernatant was collected for SDS-PAGE analysis.

[0056] Separation and purification of the target protein: 3L of expression bacteria, centrifug...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a thrombolysis protease gene NKS1. The gene is used for encoding a protease with an amino acid sequence represented by SEQ ID NO:1 in the sequence list, or a protease with a homology above 70% with the amino acid sequence represented by SEQ ID NO:1. According to the invention, with a DNA re-organization technology, a novel natto kinase NKS1 is obtained. The gene encodes natto kinase with a stronger activity than wild natto kinase genes.

Description

[0001] technical field [0002] The invention relates to the fields of genetic engineering and molecular biology. Specifically, the present invention relates to a gene of thrombolytic protease whose function is significantly improved by using DNA shuffling technology, and using the gene to produce thrombolytic drugs. [0003] Background technique [0004] With the improvement of living standards and the prolongation of life expectancy, the incidence and mortality of thrombosis are increasing day by day, and it has become the number one killer of human diseases. Dissolving thrombus is an important means to treat this kind of diseases, so finding ideal thrombolytic drugs has become a very active field of research at home and abroad, and has great scientific value, economic value and social benefits. [0005] Natto is an ancient health food that has been recognized by the people for thousands of years. In recent years, studies have found that there are fibrinolytic enzymes i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/57C12N15/63C12N15/10C12Q1/68G06F19/22A61K38/48A61K48/00A61P7/02
Inventor王沁夏涛
Owner南京百吉生物科技有限公司