2 type subunit vaccine for porcine circovirus as well as preparation method and application thereof

A subunit vaccine, porcine circovirus technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve the problems of unoptimized production process conditions, loss of protein immunogenicity, and difficulty in cultivation. , to achieve the effect of improving viral protein yield and quality, enhancing specific antibody response, and improving immunogenicity

Inactive Publication Date: 2012-06-27
WUHAN CHOPPER BIOLOGY
View PDF4 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, domestically produced vaccines are whole-virus inactivated vaccines. For example, document CN101240264A discloses a whole-virus inactivated vaccine, but PCV2 has weak proliferative ability in vitro cells, and it is difficult to cultivate, and the final titer of the virus is low. The antigen content is limited, and the preparation of high-quality PCV2 vaccines requires concentrated viral antigens, which will directly lead to high vaccine production costs and cannot meet the actual requirements of animal vaccines with high quality and low price
Documents CN101180406A, CN101884787A and CN101358182A all disclose the expression of Cap protein encoded by PCV2 ORF2 gene with recombinant baculovirus, and use it to prepare PCV2 vaccine, wherein, the described recombinant baculovirus contains only one promoter and is not optimized The production process conditions lead to low yield and quality of viral protein, and the expressed target gene is modified with other redundant sequences (such as 6×His tag, secretory signal peptide, etc.), which is not conducive to the expression of foreign proteins. The source protein forms virus-like particles (VLPs), and these recombinant baculovirus construction technology strategies have the defect of partial loss of immunogenicity of the expressed target protein
In addition, due to factors such as adjuvants and immune stimulants of the subunit vaccine, the immune effect in practice is not good

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 2 type subunit vaccine for porcine circovirus as well as preparation method and application thereof
  • 2 type subunit vaccine for porcine circovirus as well as preparation method and application thereof
  • 2 type subunit vaccine for porcine circovirus as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Construction of recombinant baculovirus

[0062] Use the Bac-to-Bac system to construct recombinant baculovirus, and design the following primers according to the gene sequence published by GENBANK (NCBI accession number EU340257.1):

[0063] P1: TCTGGATCCATGACGTATCCAAGGAGGCG

[0064] P2: GCGAAGCTTTAAGGGTTAAGTGGGGGTC

[0065] P3: TCTCTCGAGATGACGTATCCAAGGAGGCG

[0066] P4: GCGGGTACCTAAGGGTTAAGTGGGGGGTC

[0067] Using the PCV2b strain virus ORF2 sequence as a template (the template is synthesized according to the published PCV2b ORF2 sequence: accession number EU340257.1), P1 and P2 amplify the PCV2 ORF2 gene, and clone the gene into the pMD-19T vector to obtain The recombinant vector pMD-19T-ORF2-1 uses the PCV2b strain ORF2 sequence as a template, amplifies the PCV2 ORF2 gene at P3 and P4, and clones the gene into the pMD-19T vector to obtain the recombinant vector pMD-19T-ORF2-2 .

[0068] Digest pMD-19T-ORF2-1 with BamH I and Hind III, clone the ORF2 ...

Embodiment 2

[0069] Example 2 Serum-free Suspension Culture of Insect Cells in a Bioreactor and Quantification of Cap Protein Expression

[0070] Aseptically culture Sf9 insect cells in a 1000ml shake flask for 3-4 days until the concentration reaches 3-5×10 6 cells / ml, when the viability is greater than 95%, the cells were inoculated into a 5L bioreactor with an inoculation concentration of 3-8×10 5 cells / ml. When the cell concentration reaches 3-5×10 6 cells / ml, inoculate the cells into a 50L bioreactor, and wait for the cells to grow to a concentration of 3-5×10 6 cells / ml, inoculate into a 500L bioreactor until the cell concentration reaches 2-8×10 6 When cells / ml, inoculate the recombinant virus rBac-2ORF2 or rBac-ORF2, the multiplicity of infection (MOI) is 0.001-10, the reactor culture conditions are pH 6.0-6.5, temperature 25-27°C, dissolved oxygen 30-80%, stirring Speed ​​100-180rpm. Considering the optimal conditions for cell culture, the preferred pH is 6.2, the temperatu...

Embodiment 3

[0076] Example 3 Purification of VLP Particles and Observation with Electron Microscope

[0077] Harvest the expression cell culture, centrifuge the cell culture at 10,000 g at 4°C for 30 min, remove cell debris, take the supernatant, and centrifuge the supernatant at 31,000 rpm for 3 h (Beckman SW70 rotor), resuspend the precipitate with a small amount of PBS, and wait until the precipitate is completely dissolved , add CsCl according to 2.1g / 4.5ml solution, mix evenly, dispense into 5ml ultracentrifuge tubes, add PBS to a distance of 2-3mm from the tube mouth, after accurate balance, centrifuge at 149000g at 10°C for 24h. After centrifugation, two light yellow transparent bands can be seen. The target band (lower band) is aspirated and collected, which is the purified virus-like particles.

[0078] Under the same conditions, culture an equal amount of cell cultures expressing rBac-ORF2 and rBac-2ORF2, and treat them according to the above method, dilute the aspirated targ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a 2 type subunit vaccine for a porcine circovirus as well as a preparation method and application thereof. A recombinant bacilliform virus contains double promoters (a polyhedrin promoter and a P10 promoter), a coding gene of a Cap protein with double copying can be expressed, and the expression efficiency of the protein is obviously enhanced; moreover, the Cap protein expressed by an inserted foreign gene does not contain an excess sequence, virus-like particles (VLPs) can be effectively formed, and the immunogenicity of an expressed protein is enhanced; furthermore, a produced antigen has high content; and according to the 2 type subunit vaccine for the porcine circovirus, which is disclosed by the invention, the productivity ratio and the quality of a viral protein of the 2 type subunit vaccine for the porcine circovirus are obviously enhanced, and a prepared vaccine composition has the advantages of stable and persistent immune effect, high safety and the like.

Description

technical field [0001] The invention relates to the technical field of veterinary biological products, in particular to a porcine circovirus type 2 subunit vaccine and a preparation method and application thereof. Background technique [0002] Porcine circovirus type 2 (PCV2) is the main causative agent of multisystemic wasting syndrome (PMWS) in weaned piglets, which is characterized by immunosuppression and multisystem failure in weaned piglets. , anemia, dyspnea, diarrhea, weakness, slow weight gain, swollen lymph nodes and other clinical symptoms. Since the outbreak of PMWS in Canadian pig herds in 1991, PMWS has caused great economic losses to the swine industry worldwide. PCV2 can not only cause the failure of multiple systems in weaned piglets, but also damage the immune function of infected pigs, resulting in a decrease in the body's resistance, causing secondary infections and aggravating the disease. In addition, PCV2 has been associated with conditions such as r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/866C12N7/01C12N15/34C07K14/01A61K39/12A61P31/20C12R1/93
Inventor朱薇熊媛媛漆世华张萍秦红刚李伟廖园园谢红玲温文生王桢桢靖志强吴玉石韩兴刘洁
OwnerWUHAN CHOPPER BIOLOGY