Fluorescence quantitative polymerase chain reaction (PCR) detecting method for silkworm cytoplasmic polyhedrosis virus
A qualitative polyhedron, fluorescence quantitative technology, applied in fluorescence/phosphorescence, microbial determination/inspection, biochemical equipment and methods, etc., can solve the problems of PCR products polluting the environment, unsuitable for high-throughput detection, and inability to quantify. , to avoid PCR product contamination, good linear relationship, and high throughput.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0017] Step 1, design specific primers
[0018] The silkworm plastopolyhedrin gene sequence (Accession No. AB003361) was retrieved from the gene database, and a specific primer was designed using Primer Premier 5.0 software. The target amplified fragment was 118 bp (SEQ ID NO: 1). The designed primer sequences are:
[0019] Forward primer: 5'ATACAAGGTTGGCATTTCAGA 3', (SEQ ID NO: 2)
[0020] Reverse primer: 5'ACCGCCGTTAGGATAGTAGAT 3'. (SEQ ID NO: 3)
[0021] Step 2, Construction of Quantitative Standard Plasmid
[0022] Using the extracted silkworm plasmopolyhedrosis virus RNA as a template, apply Primer script TM cDNA was synthesized by reverse transcription with RT reagent kit (purchased from TaKaRa Company). The total reaction system is 20μL, of which, 5×Primer script TM Buffer 4 μL, Primer script TM RT Enzyme Mix I 1 μL, Oligo dT Primer 1 μL, Random 6mers 1 μL, Total RNA (1 μg) 2 μL, RNase-free water 11 μL. The reaction conditions are: 37°C for 15 minutes, 85°C f...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| correlation coefficient | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 