Fluorescence quantitative polymerase chain reaction (PCR) detecting method for silkworm cytoplasmic polyhedrosis virus

A qualitative polyhedron, fluorescence quantitative technology, applied in fluorescence/phosphorescence, microbial determination/inspection, biochemical equipment and methods, etc., can solve the problems of PCR products polluting the environment, unsuitable for high-throughput detection, and inability to quantify. , to avoid PCR product contamination, good linear relationship, and high throughput.

Inactive Publication Date: 2013-12-04
JIANGSU UNIV OF SCI & TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conventional PCR method requires electrophoresis detection after amplification, which is likely to cause PCR product contamination and environmental pollution, cannot be quantified, and is not suitable for high-throughput detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence quantitative polymerase chain reaction (PCR) detecting method for silkworm cytoplasmic polyhedrosis virus
  • Fluorescence quantitative polymerase chain reaction (PCR) detecting method for silkworm cytoplasmic polyhedrosis virus
  • Fluorescence quantitative polymerase chain reaction (PCR) detecting method for silkworm cytoplasmic polyhedrosis virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0017] Step 1, design specific primers

[0018] The silkworm plastopolyhedrin gene sequence (Accession No. AB003361) was retrieved from the gene database, and a specific primer was designed using Primer Premier 5.0 software. The target amplified fragment was 118 bp (SEQ ID NO: 1). The designed primer sequences are:

[0019] Forward primer: 5'ATACAAGGTTGGCATTTCAGA 3', (SEQ ID NO: 2)

[0020] Reverse primer: 5'ACCGCCGTTAGGATAGTAGAT 3'. (SEQ ID NO: 3)

[0021] Step 2, Construction of Quantitative Standard Plasmid

[0022] Using the extracted silkworm plasmopolyhedrosis virus RNA as a template, apply Primer script TM cDNA was synthesized by reverse transcription with RT reagent kit (purchased from TaKaRa Company). The total reaction system is 20μL, of which, 5×Primer script TM Buffer 4 μL, Primer script TM RT Enzyme Mix I 1 μL, Oligo dT Primer 1 μL, Random 6mers 1 μL, Total RNA (1 μg) 2 μL, RNase-free water 11 μL. The reaction conditions are: 37°C for 15 minutes, 85°C f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
correlation coefficientaaaaaaaaaa
Login to view more

Abstract

The invention discloses a fluorescence quantitative polymerase chain reaction (PCR) detecting method for a silkworm cytoplasmic polyhedrosis virus, which belongs to the technical field of biology. The method includes construction of standard plasmids, design of specificity primers, amplification of real-time fluorescence quantitive PCR and building of a standard curve, extraction of ribonucleic acid (RNA) of a sample infected by the virus, preparation of complementary deoxyribonucleic acid (cDNA) and judging of detecting results. The fluorescence quantitative PCR detecting method is high in flexibility, good in stability, strong in specificity, capable of being quantitative and suitable for mass detecting of virus infection.

Description

technical field [0001] The invention discloses a fluorescent quantitative PCR detection method for silkworm cytoplasmic polyhedrosis virus (BmCPV), which belongs to the field of biotechnology. Background technique [0002] Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) belongs to the Reoviridae family and is one of the main pathogens that harm sericulture, causing huge economic losses in production. The diameter of BmCPV virus particles is about 50-65nm, the shape is icosahedron, and it has a unique single-layer capsid structure. The genome consists of 10 segments of double-stranded RNA molecules. At present, the plasmotype polyhedrosis virus is divided into 14 electrophoretic types according to the difference in electrophoretic mobility, and BmCPV belongs to type I. Its host domains are mainly insects of Lepidoptera, Diptera, Hymenoptera and Coleoptera. BmCPV exclusively infected silkworm midgut epithelial cells, and the main organelles of silkworm midgut epithelial c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64
Inventor 吴萍郭锡杰李龙陈涛
Owner JIANGSU UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products