Root-specific and harm inducible promoter from glycine max

An injury-inducible, root-specific technology, applied in the field of genetic engineering, can solve the problems of low degree of homology of promoter sequences, few studies on crop practicability, differences in induction and activation activities, etc., and achieves the effect of high-efficiency injury-inducible expression characteristics.

Inactive Publication Date: 2012-08-01
QINGDAO AGRI UNIV
View PDF9 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the degree of homology between the above-mentioned promoter sequences is low, and there are differences in the regulatory elements that respond to external environmental conditions in the promoters, and there are differences in the induction and activation activities of each promoter.
So far, the genetic transformation research on the regulatory mechanism of the chitinase gene promoter is limited to a few model plants, and there are few practical studies on crops, let alone its genetic transformation in soybeans. to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Root-specific and harm inducible promoter from glycine max
  • Root-specific and harm inducible promoter from glycine max
  • Root-specific and harm inducible promoter from glycine max

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Cloning and sequence analysis of soybean chitinase gene promoter-GmChi1p

[0059] According to the soybean Class I chitinase gene (Chitinase, GmChi1) (GenBank: AF202731.1) sequence reported in GenBank, search and determine the GmChi1 gene in the soybean database (http: / / soybase.org / SequenceIntro.php) Design specific primers for the 5'upstream promoter region. Upstream primer: 5'CCCTAACTAGGAATTTAGCCACTCA3'

[0060] Downstream primer: 5'GAAAGAAACGGTGTATGATGTGAAT3'

[0061] Using the soybean "Jungery" genomic DNA as a template, PCR amplification was performed using the above primers to prepare the GmChi1 gene promoter fragment. PCR reaction system:

[0062]

[0063] PCR reaction program: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 50 seconds, extension at 72°C for 2 minutes, a total of 35 cycles; final extension at 72°C for 10 minutes; incubation at 4°C.

[0064] The amplified product obtained is dete...

Embodiment 2

[0067] Example 2 Using pCAMBIA1391Z vector to construct GmChi1p::GUS fusion gene recombinant expression vector

[0068] The vector plasmid pCAMBIA1391Z was extracted from Escherichia coli (the strain was purchased from a biological company or CAMBIA), and a large vector fragment (which contained the GUS reporter gene sequence) was recovered after double digestion with Hind III / EcoR I. The plasmid pMD18-T-GmChi1p was extracted from the TA clone prepared in Example 1, and after double digestion with Hind III / EcoR I, the GmChi1p promoter fragment was recovered by agarose gel electrophoresis. The above two fragments were ligated overnight at 16°C under the catalysis of ligase to complete the construction of the GmChi1p::GUS fusion gene on the pCAMBIA1391Z vector. figure 2 ).

[0069] Connection system:

[0070]

[0071] The ligation product was transformed into Escherichia coli DH5α competent cells, and the method was the same as in Example 1. Select the white colony on the...

Embodiment 3

[0072] Example 3 Agrobacterium-mediated genetic transformation of tobacco and detection of GUS expression in transgenic plants

[0073] Tobacco leaves (size 0.5×0.5) were transformed with liquid leaf disc method of Agrobacterium tumefaciens containing pCAM1391Z-GmChi1p plasmid, co-cultured for 2 days, and then transferred to differentiation medium (containing 50 mg / L hygromycin) for resistance Screening, subculture the resistant callus once every two weeks, until the emergence of resistant seedlings, move to the rooting medium (containing 50mg / L hygromycin) to take root, harden the seedlings and transplant, until the harvest T 1 generation seeds. The obtained resistant plants were positively detected by PCR method, the primers were the internal primers of gus gene and hyg gene respectively, and the product sizes were 559bp and 706bp respectively (attached image 3 ).

[0074] Transgenic tobacco was subjected to GUS histochemical staining. Method, utilize X-Gluc reaction liq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a root-specific and harm inducible promoter GmChi1p separated from glycine max. A nucleotide sequence is shown as SEQ ID NO.1. A glycine max chitinase 1 gene promoter (GmChi1p) is cloned, and a plant expression vector pCAM1391Z-GmChi1p is constructed by a primer designed uniquely and taking deoxyribonucleic acid (DNA) of a glycine max 'Jungery' genome as a template; and functional verification is performed by bacillus-mediated tobacco genetic transformation and a mode of expressing a glucuronidase (GUS) gene, namely the promoter can drive the GUS gene to be expressed specifically in roots of transgenic tobaccos and to be subjected to inducible expression efficiently by harm in the transgenic tobaccos. The promoter can replace a 35S promoter to be applied to the study of transgenic plants, and particularly the study of the pest and disease resistance, adverse resistance, high yield or quality improvement of transgenic crops.

Description

technical field [0001] The invention relates to a plant gene promoter and its application, and provides a root-specific and injury-inducible promoter obtained from soybean. It belongs to the field of biotechnology, especially related to the field of genetic engineering such as crop resistance to diseases and insect pests, stress resistance, high yield or quality improvement. Background technique [0002] Soybean (Glycine max L.Merrill) is an important oil crop and economic crop, and plays an important role in my country's agricultural production and even the entire national economy. In soybean production, there have been a variety of pests and diseases for a long time, among which soybean gray spot, Phytophthora root rot, downy mildew, soybean root-knot nematode, etc. are the most serious. Fungal diseases and insect pests lead to the decline of soybean quality and yield. important reason. Introducing related resistance genes into soybeans through genetic engineering techno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/63C12N15/84C12N1/21A01H5/00
Inventor薛仁镐赵春梅吴秀芸蔡春梅
OwnerQINGDAO AGRI UNIV