Root-specific and harm inducible promoter from glycine max
An injury-inducible, root-specific technology, applied in the field of genetic engineering, can solve the problems of low degree of homology of promoter sequences, few studies on crop practicability, differences in induction and activation activities, etc., and achieves the effect of high-efficiency injury-inducible expression characteristics.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1: Cloning and sequence analysis of soybean chitinase gene promoter-GmChi1p
[0059] According to the soybean Class I chitinase gene (Chitinase, GmChi1) (GenBank: AF202731.1) sequence reported in GenBank, search and determine the GmChi1 gene in the soybean database (http: / / soybase.org / SequenceIntro.php) Design specific primers for the 5'upstream promoter region. Upstream primer: 5'CCCTAACTAGGAATTTAGCCACTCA3'
[0060] Downstream primer: 5'GAAAGAAACGGTGTATGATGTGAAT3'
[0061] Using the soybean "Jungery" genomic DNA as a template, PCR amplification was performed using the above primers to prepare the GmChi1 gene promoter fragment. PCR reaction system:
[0062]
[0063] PCR reaction program: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 58°C for 50 seconds, extension at 72°C for 2 minutes, a total of 35 cycles; final extension at 72°C for 10 minutes; incubation at 4°C.
[0064] The amplified product obtained is dete...
Embodiment 2
[0067] Example 2 Using pCAMBIA1391Z vector to construct GmChi1p::GUS fusion gene recombinant expression vector
[0068] The vector plasmid pCAMBIA1391Z was extracted from Escherichia coli (the strain was purchased from a biological company or CAMBIA), and a large vector fragment (which contained the GUS reporter gene sequence) was recovered after double digestion with Hind III / EcoR I. The plasmid pMD18-T-GmChi1p was extracted from the TA clone prepared in Example 1, and after double digestion with Hind III / EcoR I, the GmChi1p promoter fragment was recovered by agarose gel electrophoresis. The above two fragments were ligated overnight at 16°C under the catalysis of ligase to complete the construction of the GmChi1p::GUS fusion gene on the pCAMBIA1391Z vector. figure 2 ).
[0069] Connection system:
[0070]
[0071] The ligation product was transformed into Escherichia coli DH5α competent cells, and the method was the same as in Example 1. Select the white colony on the...
Embodiment 3
[0072] Example 3 Agrobacterium-mediated genetic transformation of tobacco and detection of GUS expression in transgenic plants
[0073] Tobacco leaves (size 0.5×0.5) were transformed with liquid leaf disc method of Agrobacterium tumefaciens containing pCAM1391Z-GmChi1p plasmid, co-cultured for 2 days, and then transferred to differentiation medium (containing 50 mg / L hygromycin) for resistance Screening, subculture the resistant callus once every two weeks, until the emergence of resistant seedlings, move to the rooting medium (containing 50mg / L hygromycin) to take root, harden the seedlings and transplant, until the harvest T 1 generation seeds. The obtained resistant plants were positively detected by PCR method, the primers were the internal primers of gus gene and hyg gene respectively, and the product sizes were 559bp and 706bp respectively (attached image 3 ).
[0074] Transgenic tobacco was subjected to GUS histochemical staining. Method, utilize X-Gluc reaction liq...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 