Cell protective agent containing metallothionein

A metallothionein and protective agent technology, applied in animal cells, extracellular fluid diseases, vertebrate cells, etc., can solve problems such as death, low cell survival rate, and decline

Inactive Publication Date: 2012-08-15
汪志友
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because it is a non-nervous tissue source, it must go through in vitro induction, differentiation, and regulation stages. Under complex in vitro conditions, cells are prone to cell damage, leading to decline and death, resulting in a very low cell survival rate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Rat bone marrow mesenchymal stem cells (BMSCs) were isolated and cultured by density gradient centrifugation, and their differentiation into neural stem cells (NSCs) was promoted with a special medium for neural stem cells, and three concentrations of metallothionein were added to the medium The obtained bone marrow-derived neural stem cells (BMSCs-d-NSCs) were cultured in a CO2 incubator at 37°C, and detected by Annexin V-EGFP / PI double-staining flow cytometer at 1, 2, 3, and 4 weeks respectively , using the same cultured cells without adding metallothionein at the same time as the control, comparing the apoptosis and necrosis of each group. The results showed that after the subculture of cells in each group, the metallothionein treatment group had more vigorous vigor, faster proliferation and less apoptosis and necrosis than the control group. The proportions of apoptotic cells and necrotic cells were significantly different among the groups after 2 weeks of culture; ...

Embodiment 2

[0036] Take the bone marrow mononuclear cells of Balb / c mice, and use the plasma clot method to divide the cells (2x10 5 / petri dish) was added to the culture solution containing 10% 2-mercaptoethanol, 10% calcium chloride, 10% bovine serum albumin, 5% porcine serum, and 10% bovine plasma, and three kinds of 0.5μM, 1μM, 5μM The concentration of metallothionein in the culture solution was cultured in a CO2 incubator at 37°C, and detected by Annexin V-EGFP / PI double-stained flow cytometry at 1, 2, 3, and 4 weeks respectively. The cells cultured with sulfur protein at the same time were used as the control, and the apoptosis and necrosis of the cells in each group were compared. The results showed that after the subculture of cells in each group, the metallothionein treatment group had more vigorous vigor, faster proliferation and less apoptosis and necrosis than the control group. Flow cytometry showed that the percentages of apoptotic cells and necrotic cells were significantl...

Embodiment 3

[0038] The stable human iPS cells passaged by type IV collagenase digestion method were used to detect and identify human iPS pluripotency genes OCT4 (upstream primer CGAAGAGAAAGCGAACCAGTATC, downstream primer AGAACCACACTCGGACCACATC), Sox2 (upstream primer CCCCCGGCGGCAAATGCA, downstream primer TCGGCGCCGGGGAGATACAT), Nanog( The upstream primer is GCAAAAAAGGAAGACAAGGTCC, the downstream primer is CCTTCTGCGTCACACCATTG), and its stem cell characteristics are tested. Cultured in a CO2 incubator at 37°C with iPS stem cell medium supplemented with 0.5 μM, 1 μM, and 5 μM metallothionein cytoprotectant. The apoptosis and necrosis of each group were detected by flow cytometry as in the above examples. The proportions of apoptotic cells and necrotic cells were significantly different among the groups after 2 weeks of culture; the proportions of apoptotic and necrotic cells in the 1 μM and 5 μM metallothionein treatment groups were significantly less than those in the control group. The d...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses cell protective agent containing metallothionein, which aims to solve the problems that blood cells are damaged during blood perfusion, corresponding tissues and organs during growth are damaged after the cells are cultured and augmented in vitro and transplanted and survival rate is low and the like, and can be used for blood perfusion treatment method and cell treatment method including a method for protecting the corresponding tissues and organs after vitro-culturing, augmenting and transplanting of the cells. The cell protective containing metal sulfur protein can be widely used for protecting blood cells of human bodies with diseases such as uremia, critical illness, intoxication, systemic lupus erythematosus (SLE), severe hepatitis and the like during blood perfusion treatment, and protecting corresponding cultured and augmented cells or transplanted and hyperplasia cells of the corresponding tissues and organs in the cell treatment of diseases caused by severe damage or reduction of the cells.

Description

technical field [0001] The invention relates to a cell protection agent containing metallothionein, which belongs to the field of biopharmaceuticals. Specifically, it relates to the new use of metallothionein, that is, a reagent with metallothionein as the main component, which is used in the protection of human blood cells during hemoperfusion therapy, and in cell therapy for diseases caused by severe damage or reduction of cells Protection of corresponding cultured and expanded cells, or transplanted and proliferated cells in corresponding tissues and organs. These diseases caused by severe damage or loss of cells include but are not limited to Parkinson's disease, acute spinal cord injury, multiple sclerosis, Alzheimer's disease, arthritis, osteoporosis, heart failure, sudden thrombocytopenia, cardiac surgery Acute kidney injury, cytopenia caused by chemotherapy drugs, pulmonary fibrosis, diabetes, liver cirrhosis, premature ovarian failure, leukemia, femoral necrosis, hep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/071A61K38/16A61P7/08
Inventor汪志友
Owner汪志友