Unlock instant, AI-driven research and patent intelligence for your innovation.

LCT-EC 52 bacteria strain of esherichia coli under space environment

A technology of LCT-EC52 and Escherichia coli, which is applied in the direction of bacteria, microorganisms, biochemical equipment and methods, and can solve problems such as food poisoning

Inactive Publication Date: 2015-02-25
GENERAL HOSPITAL OF PLA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most strains of E. coli are harmless, but some serotypes can cause severe food poisoning in humans

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LCT-EC 52 bacteria strain of esherichia coli under space environment
  • LCT-EC 52 bacteria strain of esherichia coli under space environment
  • LCT-EC 52 bacteria strain of esherichia coli under space environment

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0023] Specific implementation example one phenotype of LCT-EC52

[0024] 1. Strain: Escherichia coli LCT-EC52 The preservation number is: CGMCC

[0025] 2. Morphology: The original sample was diluted and spread, and then Gram stained. LCT-EC52 is a Gram-negative bacillus without spores, and the bacteria are arranged in a single way, such as figure 1 .

[0026] 3. Identification of 16s rDNA of LCT-EC52 strain: 16S rDNA is the gene of 16S rRNA sequence, about 1.5kb in length. Amplify the 16S rDNA of the purified single bacteria directly by bacterial liquid PCR, and some single bacteria that are difficult to amplify by bacterial liquid PCR are expanded and cultured, and then the genome is extracted and then amplified. The primer sequence used for amplification is as follows: SgF(AGAGTTTGATCATGGCTCAG) , SgR (TAGGGTTACCTTGTTACGACTT), 16S rDNA PCR products were purified with a 96-well millpore purification system and quantified accurately, sequenced by an ABl3730xl automatic seq...

specific Embodiment 2 LCT-EC52SolexaDNAPaired-End。DNA, approach LCT-EC52,、、、、75%、RNaseRNA and DNALCT-EC52DNA, test 。CovarisDNA  1 DNA;T4DNA Polymerase、KlenowDNA Polymerase and T4PNK,3′“A”,DNA and 3′“T”,,PCRDNA;500bp and 6000bp。 to and ;SOAPdenovo V1.05 and SOAPaligner/soap2reads。 and ;Glimmer3.0 and , to corresponding 。LCT-EC525,209,752bp,GC50.37%。191contigs,37scaffolds。Glimmer version3.025,075。SNP,1,SNP, and and 。 specific Embodiment 3

[0033] 7. Growth curve measurement: After the strain is activated, it is inoculated into a 100-hole honeycomb plate, and the growth curve is measured in the Bioscreen, measured for 24 hours, and the data is read. Calculate the average value of the obtained OD value, and then draw the curve. Compared with the ground control strain LCT-EC106 of Escherichia coli space strain LCT-EC52, there is no significant difference in its growth curve, as shown in image 3. Specific implementation example 2 Whole genome sequencing of Escherichia coli space-mutated strain LCT-EC52 High-throughput Solexa sequencing technology was used to perform Paired-End sequencing on the DNA of the sample. Firstly, the genomic DNA of the bacteria was extracted, and the cells of E. coli LCT-EC52 were collected by centrifugation. After resuspension, lysis, extraction with phenol and chloroform, precipitation with isopropanol, washing with 75% ethanol, removal of RNA by RNase, and dissolution of genomic DNA, t...

specific Embodiment 4

[0037] The proteomics of E.coli space mutagenesis bacterial strain LCT-EC52 of concrete implementation example

[0038] We used iTRAQ relative quantification technology to conduct proteomic research on Escherichia coli space mutant strains and ground control strains. First, the protein is extracted from the sample, and the extracted protein sample is reductively alkylated to open the disulfide bond so that the protein can be fully enzymatically hydrolyzed. The concentration of protein was determined by the 2Dquant kit method of GE Company. SDS (sodium dodecylsulfonate) electrophoresis was carried out with equal volume. Proteins are digested into peptides using trypsin. Peptides were labeled with iTRAQ reagent. The labeled peptides were mixed in equal amounts, and the mixed peptides were pre-separated by strong cation exchange chromatography (SCX) for liquid phase tandem mass spectrometry (LC-MS / MS) analysis. For the original file of the mass spectrometer, perform peak iden...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to Escherichia coli under space environment and genomic sequence thereof. Previous study shows that space environment can affect a plurality of characteristics of microorganism, such as growth rate, cellular morphology, cell metabolism level, production of biofilm, increase or reduction of virulence and drug tolerance. By utilizing special space environment, the Escherichia coli is sent to outer space through the Shenzhou 8 and returns to the ground after flight of 398 hours for 11 million kilometers, phenotypic correlation experiment is carried out and proves that bacterial strain of eschreichia coli that induced by space environment has obvious variation. Then genomic sequencing, transcriptome sequencing and proteomics analysis are carried out on the bacteria strain, so as to find out potential mechanism for the variation and application thereof. Deep study of the problems is beneficial for us to discover and realize the effect of space environment and pathogenicity mechanism on Escherichia coli, thus providing theoretical basis for guaranteeing safety of astronauts.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to biological characteristics of Escherichia coli in a space environment, whole genome sequencing, transcriptome sequencing and differential proteomics analysis. Background technique [0002] With the increasing frequency of human space exploration activities, space has become an important field of human activities. Microorganisms are part of the natural environment, and they exist in various parts of the biosphere such as air, water, and soil. Therefore, human space activities inevitably bring microorganisms into space. Despite the extreme and complex environment of outer space, these microorganisms are able to adapt to these changes such as microgravity, cosmic rays, temperature, pressure, etc. and exhibit corresponding changes in morphology and physiology. In particular, studies have found that the virulence of Salmonella typhimurium cultured under simulated microgravity conditions f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20C12R1/19
Inventor 刘长庭李天志方向群王俊峰郭英华常德苏龙翔王雅娟陈振鸿刘岩
Owner GENERAL HOSPITAL OF PLA