Detection kit for mycoplasma pneumonia (MP)
A detection kit and technology for Mycoplasma pneumoniae, which can be used in the determination/testing of microorganisms, fluorescence/phosphorescence, biochemical equipment and methods, etc. It can solve the problems of low detection sensitivity and lack of quality control system for kits, and achieve reliable experiments basis, simple method, and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The present embodiment provides a specific Mycoplasma pneumoniae detection kit, which includes the following components:
[0026] ①MP concentrate: Contains 50mM / L polyethylene glycol 6000 (PEG-6000) and 100mM / L sodium chloride.
[0027] ② Nucleic acid release agent: Contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.
[0028] ③ Internal standard (positive internal control): It is a recombinant of a 100 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 2.00E+04copies / ml, and the 100 base pair sequence is: 5'-CCTCTAGCGCTGCGAATAGAACTTCCTCTGTTCAAGCCTTCCCTTTATACGCTCAAGCTGGTTTCTTCTCAAGGTTCAAGCAATAGAAACGGAGATCTAC-3'.
[0029] ④PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for targ...
Embodiment 2
[0035] This embodiment provides the operation steps of the kit described in the above embodiment 1 for detecting MP-DNA in unknown samples such as sputum and throat swabs:
[0036] 1. Reagent preparation
[0037] According to the number of samples to be tested, MP negative control, MP positive control, and MP quantitative reference products A~D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) and content in proportion. Label 0.4μl / person, and mix thoroughly to form a PCR-mix. For example, when the sample to be tested is 3 people, a total of 9 people need to be prepared (the number of people in the above four is 3, 1, 1 and 4 respectively). PCR-mix; ready for use after brief centrifugation.
[0038] 2. Nucleic acid extraction
[0039] 1. Sputum: Use a gun tip to pick an appropriate amount of sputum and place it in a 1.5ml sterilized centrifuge tube, add 1ml of normal saline, shake and mix well, then let it stand for an hour ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap