Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit for mycoplasma pneumonia (MP)

A detection kit and technology for Mycoplasma pneumoniae, which can be used in the determination/testing of microorganisms, fluorescence/phosphorescence, biochemical equipment and methods, etc. It can solve the problems of low detection sensitivity and lack of quality control system for kits, and achieve reliable experiments basis, simple method, and high detection sensitivity

Active Publication Date: 2013-04-24
SANSURE BIOTECH
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, kits for the quantitative detection of MP-DNA based on real-time fluorescent quantitative PCR technology have been used in clinical detection at home and abroad, but most of these kits use the boiling method to extract nucleic acids, and the detection sensitivity is not high, about 500~1000copies / ml In addition, most of these kits lack a complete quality control system, and further improvement and technical level are needed to make such products more meet the needs of clinical and accurate diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for mycoplasma pneumonia (MP)
  • Detection kit for mycoplasma pneumonia (MP)
  • Detection kit for mycoplasma pneumonia (MP)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The present embodiment provides a specific Mycoplasma pneumoniae detection kit, which includes the following components:

[0026] ①MP concentrate: Contains 50mM / L polyethylene glycol 6000 (PEG-6000) and 100mM / L sodium chloride.

[0027] ② Nucleic acid release agent: Contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), 0.1% of ethanol and solvent TE buffer.

[0028] ③ Internal standard (positive internal control): It is a recombinant of a 100 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 2.00E+04copies / ml, and the 100 base pair sequence is: 5'-CCTCTAGCGCTGCGAATAGAACTTCCTCTGTTCAAGCCTTCCCTTTATACGCTCAAGCTGGTTTCTTCTCAAGGTTCAAGCAATAGAAACGGAGATCTAC-3'.

[0029] ④PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for targ...

Embodiment 2

[0035] This embodiment provides the operation steps of the kit described in the above embodiment 1 for detecting MP-DNA in unknown samples such as sputum and throat swabs:

[0036] 1. Reagent preparation

[0037] According to the number of samples to be tested, MP negative control, MP positive control, and MP quantitative reference products A~D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) and content in proportion. Label 0.4μl / person, and mix thoroughly to form a PCR-mix. For example, when the sample to be tested is 3 people, a total of 9 people need to be prepared (the number of people in the above four is 3, 1, 1 and 4 respectively). PCR-mix; ready for use after brief centrifugation.

[0038] 2. Nucleic acid extraction

[0039] 1. Sputum: Use a gun tip to pick an appropriate amount of sputum and place it in a 1.5ml sterilized centrifuge tube, add 1ml of normal saline, shake and mix well, then let it stand for an hour ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection kit for mycoplasma pneumonia (PM). The detection kit comprises a nucleic acid releasing agent and PCR (polymerase chain reaction) reaction liquid, wherein the nucleic acid releasing agent comprises 0.01-0.5mM / L of surfactin, 20-300mM / L of potassium chloride, 0.01-2% of sodium dodecyl sulfate and 0.05-1% of ethanol, and the PCR reaction liquid comprises a forward primer and a reverse primer which are used for amplifying targeted polynucleotide as well as a probe for detecting the targeted polynucleotide. The detection results of extracting nucleic acid by utilizing a nucleic acid releasing method and a boiling method have no obvious difference, and a strong albuminous denaturant is utilized for destroying a coat protein structure of a pathogen rapidly so as to release the nucleic acid of the pathogen and release and extract the DNA (deoxyribonucleic acid) without heating. The sensitivity of the kit for detecting MP can reach 400copies / ml, and the quantitative linearity range is 400-4.00E+09copies / ml. The kit can be used for rapid and accurate detection of MP-DNA in unknown samples such as sputum, throat swab and the like, thus providing reliable experimental basis for mycoplasma pneumonia infection.

Description

technical field [0001] The invention provides a Mycoplasma pneumoniae MP detection kit, specifically a fluorescent PCR-based MP-DNA detection kit. Background technique [0002] Mycoplasma pneumoniae (MP) is an ultra-filtering pathogenic microorganism between bacteria and viruses, which is mainly transmitted in the form of aerosol particles through respiratory droplets. It was first isolated and cultured from the sputum of human primary atypical pneumonia (PAP) patients in 1962. Since the 1990s, with the change of pneumonia etiology, MP has become an important pathogen of pneumonia in children. MP infection not only causes lung lesions, but also invades other organs such as the heart, brain, liver, and kidney, causing a variety of extrapulmonary diseases. Performance. MP is also an important pathogen of community-acquired pneumonia (CAP), especially in children over 5 years old. MP accounts for 10-20% of CAP pathogens in non-epidemic years. Due to the slow growth of MP, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/06G01N21/64
Inventor 戴立忠邓中平艾颖娟
Owner SANSURE BIOTECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More