Harpin coding gene (i) hrpZPsgS1(/i) or application of harpinZPsgS1 protein expressed by Harpin coding gene (i) hrpZPsgS1(/i)
A technology encoding genes and proteins, applied in the application field of harpinZPsgS1 protein, can solve the problems of less research and not widely used, and achieve the effect of promoting growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1: Soybean bacterial spot pathogen S1 bacterial strain wxya PsgS1 Gene cloning and sequencing
[0039] Soybean bacterial spot pathogen S1 strain (CGMCC No.6699, the same below) was first screened on KB solid medium. The strain can secrete fluorescent pigment and can detect fluorescence under ultraviolet light. The selected monoclonal colonies were shaken and cultured in KB liquid medium for 24 hours at 28°C for extraction of genomic DNA. According to the accession number L41862 in Genbank wxya Sequence, design complete open reading frame (ORF) primers, respectively introduce at the 5' end Bam H1 and Eco R1 restriction site;
[0040] wxya PsgS1 -P1: 5'-GG GGATCC ATGCAGAGTCTCAGTCTTAAC (SEQ ID No. 3);
[0041] wxya PsgS1 -P2: 5'-GG GAATTC TCAGGCAGCAGCCTGGTTG (SEQ ID No. 4).
[0042] PCR amplification was performed using the genomic DNA of the S1 strain as a template. The reaction conditions were: pre-denaturation at 94°C for ...
Embodiment 2
[0044] Example 2: harpinZ PsgS1 Protein expression and purification
[0045] 2.1 wxya PsgS1 Construction of Genetic Engineering Expression Strains
[0046] The positive recombinant plasmid pMD18-T- wxya PsgS1 as a template for PCR amplification. The amplified product was recovered by Bam H1 and Eco After R1 double digestion, it was connected to the expression vector pET41a(+), so that wxya PsgS1 The gene is fused with the reduced glutathione GST tag on pET41a(+), and then the recombinant plasmid pET41a(+)- wxya PsgS1 . After the recombinant plasmid and pET41a(+) were transformed into Escherichia coli BL21, the positive strain was identified by plasmid PCR and enzyme digestion ( figure 1 ).
[0047] 2. 2 harpinZ PsgS1 protein expression
[0048] (1) Activated stock: recombinant strain BL21 / pET41a(+)- wxya PsgS1 Inoculate in LB liquid medium (km50μg / ml) and culture overnight at 37°C (200rpm / min), transfer to km50 liquid LB at a ratio of 1% th...
Embodiment 3
[0053] Example 3: harpinZ PsgS1 Protein bioactivity detection
[0054] The purified harpinZ PsgS1 (concentration 100μg / ml) was divided into 5 parts, 100μl each, and processed as follows: (1) 100°C boiling water bath for 10 minutes; (2) Add proteinase K (final concentration 20μg / ml), and incubate at 37°C for 15 minutes; ( 3) Add sodium vanadate (final concentration is 5×10 -5 mol / L); (4) adding lanthanum chloride (final concentration is 2×10 -3 mol / L); (5) Add cycloacetimide (final concentration is 1×10 -4 mol / L). Simultaneously with harpinZ PsgS1 Compared with water treatment, injection was made into the space between the cells on the back of tobacco leaves with a headless syringe, and the development of leaf HR was observed within 36 hours.
[0055] The results showed that purified harpinZ PsgS1 HR can still be stimulated on tobacco after being treated in a boiling water bath at 100°C for 10 minutes; harpinZ PsgS1 After proteinase K treatment, the abilit...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



