Harpin coding gene (i) hrpZPsgS1(/i) or application of harpinZPsgS1 protein expressed by Harpin coding gene (i) hrpZPsgS1(/i)

A technology encoding genes and proteins, applied in the application field of harpinZPsgS1 protein, can solve the problems of less research and not widely used, and achieve the effect of promoting growth

Inactive Publication Date: 2013-05-15
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The corresponding hrp genes have been cloned from 5 pathogenic variants of P. syringae abroad, and confirmed However, domestic studies on the hrp gene derived from Pseudomonas syringae (P. The functions are also different, and the high-efficiency expression of purified harpin protein in vitro for guiding biological control has not been widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Harpin coding gene (i) hrpZPsgS1(/i) or application of harpinZPsgS1 protein expressed by Harpin coding gene (i) hrpZPsgS1(/i)
  • Harpin coding gene (i) hrpZPsgS1(/i) or application of harpinZPsgS1 protein expressed by Harpin coding gene (i) hrpZPsgS1(/i)
  • Harpin coding gene (i) hrpZPsgS1(/i) or application of harpinZPsgS1 protein expressed by Harpin coding gene (i) hrpZPsgS1(/i)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1: Soybean bacterial spot pathogen S1 bacterial strain wxya PsgS1 Gene cloning and sequencing

[0039] Soybean bacterial spot pathogen S1 strain (CGMCC No.6699, the same below) was first screened on KB solid medium. The strain can secrete fluorescent pigment and can detect fluorescence under ultraviolet light. The selected monoclonal colonies were shaken and cultured in KB liquid medium for 24 hours at 28°C for extraction of genomic DNA. According to the accession number L41862 in Genbank wxya Sequence, design complete open reading frame (ORF) primers, respectively introduce at the 5' end Bam H1 and Eco R1 restriction site;

[0040] wxya PsgS1 -P1: 5'-GG GGATCC ATGCAGAGTCTCAGTCTTAAC (SEQ ID No. 3);

[0041] wxya PsgS1 -P2: 5'-GG GAATTC TCAGGCAGCAGCCTGGTTG (SEQ ID No. 4).

[0042] PCR amplification was performed using the genomic DNA of the S1 strain as a template. The reaction conditions were: pre-denaturation at 94°C for ...

Embodiment 2

[0044] Example 2: harpinZ PsgS1 Protein expression and purification

[0045] 2.1 wxya PsgS1 Construction of Genetic Engineering Expression Strains

[0046] The positive recombinant plasmid pMD18-T- wxya PsgS1 as a template for PCR amplification. The amplified product was recovered by Bam H1 and Eco After R1 double digestion, it was connected to the expression vector pET41a(+), so that wxya PsgS1 The gene is fused with the reduced glutathione GST tag on pET41a(+), and then the recombinant plasmid pET41a(+)- wxya PsgS1 . After the recombinant plasmid and pET41a(+) were transformed into Escherichia coli BL21, the positive strain was identified by plasmid PCR and enzyme digestion ( figure 1 ).

[0047] 2. 2 harpinZ PsgS1 protein expression

[0048] (1) Activated stock: recombinant strain BL21 / pET41a(+)- wxya PsgS1 Inoculate in LB liquid medium (km50μg / ml) and culture overnight at 37°C (200rpm / min), transfer to km50 liquid LB at a ratio of 1% th...

Embodiment 3

[0053] Example 3: harpinZ PsgS1 Protein bioactivity detection

[0054] The purified harpinZ PsgS1 (concentration 100μg / ml) was divided into 5 parts, 100μl each, and processed as follows: (1) 100°C boiling water bath for 10 minutes; (2) Add proteinase K (final concentration 20μg / ml), and incubate at 37°C for 15 minutes; ( 3) Add sodium vanadate (final concentration is 5×10 -5 mol / L); (4) adding lanthanum chloride (final concentration is 2×10 -3 mol / L); (5) Add cycloacetimide (final concentration is 1×10 -4 mol / L). Simultaneously with harpinZ PsgS1 Compared with water treatment, injection was made into the space between the cells on the back of tobacco leaves with a headless syringe, and the development of leaf HR was observed within 36 hours.

[0055] The results showed that purified harpinZ PsgS1 HR can still be stimulated on tobacco after being treated in a boiling water bath at 100°C for 10 minutes; harpinZ PsgS1 After proteinase K treatment, the abilit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to view more

Abstract

The invention discloses a Harpin coding gene (i) hrpZPsgS1(/i) and an application of a harpinZPsgS1 protein expressed by the Harpin coding gene (i) hrpZPsgS1(/i). If the obtained harpinZPsgS1 protein is used for treating tobacco plants, the growing of the tobacco plants is promoted; and the resistance of the tobacco plants against tobacco mosaic viruses and tobacco phytophthora diseases is improved obviously, wherein the resistance is not only limited in parts treated by the harpinZPsgS1 protein but also acts on the peripheral leaves and the whole plants, and the expression of PR (pathogenesis related) protein is carried out in the treating process, so that the hrpZPsgS1(/i) can induct the plant systems to obtain disease resistance. The result shows that the hrpZPsgS1 has the application value of being developed into a biogenic pesticide.

Description

technical field [0001] The invention belongs to the field of biological genetic engineering and relates to the Harpin coding gene wxya PsgS1 or its expressed harpinZ PsgS1 protein application. Background technique [0002] Soybean bacterial spot is a major disease in my country, especially in northern soybean producing areas, which has brought huge losses to agricultural production. The pathogenic bacteria Pseudomonas syringae pathogenic variety Pseudomonas syringae pv. glycinea ) is also an important plant pathogenic bacteria worldwide. Like other Gram-negative plant pathogenic bacteria, Pseudomonas syringae pv. glycinea have a conservative hrp Gene clusters determine the hypersensitive response (HR) of pathogenic bacteria on non-host plants and disease-resistant plants and the pathogenicity (pathogenicity) on susceptible hosts. hrp The specific gene-encoded product of the gene cluster, harpins, is a class of non-specific protein elicitors, which are rich i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C07K14/21C12N15/70A01N47/44A01P21/00A01P1/00A01P3/00C12R1/38
Inventor 高学文张岩伍辉军
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap