Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Haynaldia villosa disulfide isomerase gene and application thereof

A disulfide and isomerase technology, applied in the field of genetic engineering, can solve the problems of increasing manpower, material resources, environmental pollution, etc., and achieve the effect of improving resistance

Active Publication Date: 2013-05-15
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although powdery mildew can be controlled by fungicides, it will inevitably increase the input of manpower and material resources, and it will also cause ecological problems such as environmental pollution. Therefore, cultivating and promoting disease-resistant varieties has been recognized as the most economical, safe and effective way to control wheat powdery mildew. The study of disease-resistant genetic background and disease-resistant mechanism is an important basis for formulating disease-resistant breeding strategies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Haynaldia villosa disulfide isomerase gene and application thereof
  • Haynaldia villosa disulfide isomerase gene and application thereof
  • Haynaldia villosa disulfide isomerase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Using yeast two-hybrid to clone the disulfide isomerase gene Hv-PDI

[0034] Diploid pilosetris (references: Qi Lili, Chen Peidu, et al., New source of resistance to wheat powdery mildew—gene Pm21, Acta Crops Sinica, 1995, 21(3):257-262) is a material highly resistant to powdery mildew. Hv-CMPG is a powdery mildew resistance-related gene located on diploid P. villosa 6V cloned by the Institute of Cytogenetics, Nanjing Agricultural University (Liu Yuan. Cloning of Hv-CMPG gene in P. villosa and preliminary analysis of its function[D] .Nanjing.Nanjing Agricultural University, 2007), with Hv-CMPG as bait, use polyethylene glycol-lithium acetate transformation method to screen yeast two-hybrid cDNA library, get a Hv-CMPG interaction gene (attached figure 1 ). The interacting gene was sequenced, and a sequence with a size of 1615 bp was obtained, as shown in SEQ ID NO.1. Search the open reading frame of the obtained sequence through the ORF finder on the NCBI web...

Embodiment 2

[0035] Embodiment 2Hv-PDI gene is subjected to the expression characteristic that powdery mildew induces

[0036] Sowing the wheat seeds resistant to powdery mildew (references: Qi Lili, Chen Peidu, etc., new resistance source of wheat powdery mildew-gene Pm21, Acta Biological Sciences, 1995, 21(3): 257-262) in a petri dish to germinate , and transplanted to pots after dew whitening (isolated with a cylindrical transparent plastic sheet around, and closed with filter paper at the top to form an environment free of powdery mildew). At the three-leaf stage, shake off the fresh spores of Nanjing local mixed powdery mildew cultured on the susceptible variety Sumai No. 3 on the seedlings of A. The leaves of T. villosa inoculated with powdery mildew were stored at 16°C. Samples were taken at 0h, 30min, 45min, 1h, 2h, 6h, 12h, 24h, 48h, and 72h after inoculation, and stored in a -70°C refrigerator for later use. TRIZOL (Invitrogen) was used to extract RNA from the leaves of A. vill...

Embodiment 3

[0038] Example 3 Hv-PDI sense expression vector construction

[0039]Using the above-mentioned C. villosa cDNA induced by powdery mildew as a template, the primer pair P3 (CGGGATCCATGCGTCCGGCCATCC (SEQ ID NO.5)) and P4 (GGGGTACCTCACAACTCGTCGTTGGGC (SEQ ID NO.6) that can amplify the protein coding region of the Hv-PDI gene )) PCR amplification was carried out, and the amplified fragment with a size of 1323bp was recovered. The amplified fragment was inserted into pMD18-T (Takara), sequenced and compared with the original sequence, it was Hv-PDI gene, and the amplified target fragment was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA) with BamHI and Kpnl double enzyme digestion , Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J.1987, 6: 3901-3907.) Between the multiple cloning sites BamHI and Kpnl behind the 35S promoter. Thus, the target gene Hv-PDI was cloned to the downstream of the strong promote...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of genetic engineering and discloses a haynaldia villosa disulfide isomerase gene and an application thereof. The cDNA (complementary deoxyribonucleic acid) sequence of Hv-PDI (Hantaan Virus-Protein Disulfide Isomerase) is SEQ ID NO. 1, and the encoded amino acid sequence is SEQ ID NO. 2. The gene derives from diploid haynaldia villosa (haynaldia villosa VV, 2n=14), is induced by powdery mildew in powdery mildew-resistant diploid haynaldia villosa, and is greatly expressed. Through transient expression, the gene is transformed to an infected wheat variety Yangmai 158, a result shows that excessive expression of Hv-PDI is capable of reducing the haustorium index of Yangmai 158. Therefore, the Hv-PDI is expectedly used for genetic engineering breeding, and the resistance of wheat to powdery mildew is hopefully improved when the Hv-PDI is introduced to wheat varieties susceptible to powdery mildew.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses a wheat disulfide isomerase gene and its application. Background technique [0002] Wheat powdery mildew caused by the obligate parasitic fungus Blumeria graminis DC f.sp.tritici is one of the increasingly serious diseases in wheat production in China and many countries in the world. Plants can be infected by powdery mildew from the one-leaf stage to senescence. Early infection reduces tillers, and late infection of upper leaves and ears severely reduces grain yield (20%-33%). [0003] Although powdery mildew can be controlled by fungicides, it will inevitably increase the input of manpower and material resources, and it will also cause ecological problems such as environmental pollution. Therefore, cultivating and promoting disease-resistant varieties has been recognized as the most economical, safe and effective way to control wheat powdery mildew. The research on the genetic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/61C12N9/90C12N15/63A01H5/00
Inventor 王秀娥李颖波曹爱忠王海燕邢莉萍祝燕飞王慰费菲
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com