Application of fermentation supernatant liquid of pseudomonas

A technology of fermentation supernatant and pseudomonas, applied in the field of agricultural microbiology, can solve the problems of reducing pesticide residues in vegetables, producing environment, adverse effects, etc. Good control effect and good biological control effect

Inactive Publication Date: 2013-05-22
HUAZHONG AGRI UNIV +1
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, production mainly relies on fungicides to prevent and control Botrytis cinerea. Since the bacteria can develop resistance to some fungicides in a relatively short period of time, and chemical pesticides themselves have high pollution characteristics, some agricultural measures, such as raising temperature and reducing humidity, It cannot be implemented in continuous rainy days, and artificial heating will greatly increase the production cost; for a long time, rice is used for disease control, and chemical control is still the main method of disease control, relying on chemical pesticides such as carbendazim and promethazine, which leads to the rapid development of its drug resistance. produce and have adverse effects on humans and the environment. Biological pesticides have many complementary advantages. It can reduce the selectivity of Botrytis cinerea to fungicides, reduce the amount of pesticide residues in vegetables, and also reduce production costs. Therefore, biological control of Botrytis cinerea Disease has become one of the important measures for the comprehensive management of pathogenic bacteria, especially the use of antagonistic microorganisms to prevent and control diseases is of great significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of fermentation supernatant liquid of pseudomonas
  • Application of fermentation supernatant liquid of pseudomonas
  • Application of fermentation supernatant liquid of pseudomonas

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1: Identification of Pseudomonas

[0064] Step 1: Routine identification and molecular-assisted identification of Pseudomonas

[0065] Inoculate Pseudomonas sp.MCCC NO.1A00316 on 2216E medium, culture at 28°C for 48 hours, observe and record the single colony morphology, and conduct gelatin hydrolysis test at the same time (reference: Zhao Bin et al., Microbiology Experiment (First Edition) . Beijing: Science Press, 2002 introduced the method). 16S rDNA identification, using upstream primer 27F5'AGAGTTTGATCCTGGCTCAG3' and downstream primer 1492R 5'GGTTACCTGTTAC GACTT3' to amplify 16S rDNA fragments (Suzuki K et al., Agromyces mediolanus sp.nov., nom.rev., comb.nov., a species for "Corynebacterium mediolanum" Mamoli 1939 and for some aniline-assimilating bacteria which contain 2,4-diaminobutyric acid in the cell wall peptidoglycan. Int J Syst Bacterio, 1996, 46:88-93). Use 20 μl reaction system: 1 μl upstream primer 27F, 1 μl downstream primer 1492R, 0.2 μl dNT...

Embodiment 2

[0069] Example 2: In Vitro Control Experiment of A316 Fermentation Supernatant to Meloidogyne incognita

[0070] Step 1: Fermentation of A316

[0071] 1) Streak, separate and activate the A316 strain on the plate to obtain a single colony;

[0072] 2) Pick a single colony and transfer it to a PA bottle for activation in a liquid shake flask;

[0073] 3) The seed liquid in the PA bottle was transferred to a 250ml Erlenmeyer flask and cultured in a shaker flask at 28°C for 48 hours until OD 600 =1.85;

[0074] 4) The fermentation broth after shaking the flask was centrifuged at 8000 rpm for 15 minutes to obtain the A316 fermentation supernatant for later use.

[0075] The second step: Toxicity determination of A316 to root-knot nematode incognita

[0076] 1) Use a 96-well plate for toxicity determination, and absorb 30 second-instar nematodes for each well;

[0077] 2) Add 160ul of fermentation supernatant and supplement to about 200ul with sterile water;

[0078] 3) Three...

Embodiment 3

[0086] Embodiment 3: Greenhouse experiment of A316 fermentation supernatant to root-knot nematode incognita

[0087] 1) Sterilize tomato seeds, disinfect with 70% (v / v) alcohol for 1 minute, sterilize with 2% (w / w) sodium hypochlorite for 10 minutes, and wash with sterile water three times;

[0088] 2) Tomato seeds germinate on filter paper filled with water;

[0089] 3) Plant the germinated seeds into 1000g of sterile culture soil (soil:sand=1:1), and inoculate one tomato in each pot;

[0090] 4) Inoculate after growing four cotyledons. When inoculating, insert 3 small holes evenly around the tomato seedlings with a glass rod, and mix the nematode suspension (300 head / well) and (or) fermentation supernatant (2ml / well) ) into small holes respectively, and then cover with sterilized soil. Do not water within 3 days after inoculation, and use a watering can to properly moisturize the leaf and soil surfaces to prevent nematodes from being washed away, and perform normal watering...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of fermentation supernatant liquid of pseudomonas. A pseudomonas bacterial strain is activated in a plate streaking manner, a single colony on a plate is inoculated into a triangular flask filled with a culture medium 2216E, the culture temperature is 28 DEG C, the revolution of a shaker is 180rpm, the culture time is 48h, centrifugation is carried out for 15min at a speed of 8000rpm to obtain the fermentation supernatant liquid A316 which can be used for prevention and control of meloidogyneincognita, and the fermentation supernatant liquid A316 has an antagonism effect in vitro on hot pepper gray molds caused by botrytiscinerea in a greenhouse in-vivo experiment and a good control effect, promotes the growth of hot pepper and has a good application prospect.

Description

technical field [0001] The invention belongs to the technical field of agricultural microbiology, and specifically relates to the application of a Pseudomonas fermentation supernatant in the preparation of medicines for treating or preventing plant root-knot nematodes, and also relates to the preparation of a Pseudomonas fermentation supernatant. The application of the medicine for treating or preventing gray mold of pepper also relates to the application of a pseudomonas fermentation supernatant in promoting the growth of pepper. Background technique [0002] Root-knot nematode is a soil-borne disease distributed worldwide, causing great losses to agriculture, forestry, horticulture and other industries in many countries. Root-knot nematode (Meloidogyne.spp) is found in soil everywhere, especially in warmer regions. Root-knot nematode is the most widely distributed and most harmful plant parasitic nematode, which has attracted the attention of all countries in the world. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01N63/02A01P5/00A01P3/00A01P21/00C12N1/20C12R1/38
Inventor张吉斌邵宗泽张智涛唐佳频李光玉景雪萍孙凤芹喻子牛
OwnerHUAZHONG AGRI UNIV