Improved adenovirus vector system, preparation and application of its virus particle

A technology of adenovirus and recombinant adenovirus, applied in virus/bacteriophage, application, botanical equipment and methods, etc., can solve the problems of operator chemical hazards, long time-consuming, low success rate, etc., and avoid the use of harmful chemical reagents , Operation time is shortened, and reagent cost is reduced

Active Publication Date: 2013-09-11
上海诺百生物科技有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Adeno-X system uses two enzyme-cut ligation methods, but the success rate is low due to the longer viral genome (greater than 36K) in the second ligation, and the kit is expensive
Invitrogen's Virapower system uses two recombination methods to complete the recombination vector in vitro, but the two recombination requires two recombinases, which is very expensive, and the recombination enzyme is sensitive to temperature, which often leads to unstable recombination efficiency
[0005] The vectors completed in vitro recombination generally need to be digested with PacI before the virus is packaged, and the classic phenol: chloroform: isoamyl alcohol is used for purification. This method takes a long time, the recovery efficiency is not high, and there is a risk of chemical hazards to the operator.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Improved adenovirus vector system, preparation and application of its virus particle
  • Improved adenovirus vector system, preparation and application of its virus particle
  • Improved adenovirus vector system, preparation and application of its virus particle

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] The amplified MCS-IRES-GFP fragment is as follows:

[0056] Design and synthesize 2 PCR primers, the sequences are as follows:

[0057] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCGGCCGCTTTCTAGACTCAGATCTCGAGCT-3' (SEQ ID NO. 1);

[0058] 5' - GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCAT-3' (SEQ ID NO. 2).

[0059] The pIRES-EGFP vector (purchased from Clontech) was used as a template, and the above two oligonucleotide chains were used as primers to amplify to obtain the DNA fragment of MCS-IRES-GFP. The fragment amplified from the pIRES-EGFP vector contains multiple cloning sites NotI, XbaI, BglII, XhoI, SacI, EcoRI, PstI, SalI, SacII, SmaI, and BamHI.

[0060] 1) The volume of each component in the PCR system

[0061] Component

volume

Ultra-pure water

37.8μl

10XPCR buffer

5μl

Magnesium ion (25mM)

3μl

dNTPs (25mM)

0.4μl

Upstream primer (10μM)

1μl

Downstream primer (10μM)

1μl

Taq enzy...

Embodiment 2

[0068] The pDONR221 vector (Invitrogen, figure 1 ) into a pDONR-MCS-IRES-GFP vector, including purifying the above-mentioned amplified MCS-IRES-GFP fragment, performing BP recombination with pDONR221, and the obtained vector was named pDONR-MCS-IRES-GFP (see figure 2 ). details as follows:

[0069] Use Invitrogen's BP recombination system (Invitrogen's BP recombination kit) to recombine the target fragment into the vector pDONR221. Prepare the BP recombination reaction system according to the following table:

[0070] PCR product

2μl

pDONR221 plasmid

1μl

BP clonaseⅡenzyme mix

2μl

TE buffer (pH8.0)

5μl

[0071] React at 25°C for 1 hour.

[0072] Add 1 μl of proteinase K and react at 37°C for 10 minutes.

[0073] Take 5 μl of the recombination reaction solution to transform 50 μl of Escherichia coli DH5α competent cells.

[0074] Positive clones were screened and verified by sequencing, and the correct BP recombinant pl...

Embodiment 3

[0077] The pDONR-MCS-IRES-GFP vector prepared in Example 2 and the pAd / CMV / V5-DEST vector (purchased from Invitrogen, image 3 ) for LR recombination to obtain the final recombination vector pAd / MCS-IRES-GFP. details as follows:

[0078] LR recombination was performed using Invitrogen's LR recombination system (Invitrogen's LR recombination kit). Prepare the LR recombination reaction system according to the following table:

[0079] BP recombinant plasmid

1μl

pAd CMV / V5-DEST

1μl

LR clonaseⅡenzyme mix

2μl

TE buffer (pH8.0)

6μl

[0080] React at 25°C for 1 hour.

[0081] Add 1 μl of proteinase K and react at 37°C for 10 minutes.

[0082] Take 5 μl of the recombination reaction solution to transform 50 μl of DH5α competent cells.

[0083] Positive clones were screened and verified by sequencing, and the correct LR recombinant plasmids verified by sequencing were retained.

[0084] The schematic diagram of the vector const...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an improved adenovirus vector system and a virus preparation method. The system takes a pDONR221 vector as an initial vector to make improvement, and multiple cloning sites and an IRES-GFP fragment are inserted. The system combines enzyme digestion connection and recombination reaction technologies, can efficiently construct a vector, and also reduces the reagent cost. The invention also discloses an improved method of purification following after enzyme digestion of the virus vector. The method abandons traditional purification methods adopting phenol, chloroform and isoamyl alcohol, and uses a conventional DNA recovery column or direct heat inactivation method. The method is simple and feasible, shortens the operation time, reduces the material cost, and has no need for toxic phenol and chloroform reagents. The adenovirus system combining the two aspects has improved preparation efficiency and reduced cost, and still maintains high efficiency in infected cells.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to an improved adenovirus vector system and the preparation and application of virus particles. Background technique [0002] The development of adenovirus (adenovirus, Ad) as a gene expression carrier began in the early 1960s, when virologists observed that the adenovirus genome could hybridize with the simian virus 40 (SV40) genome, indicating that the adenovirus genome can carry heterogeneous source gene. Since then, adenovirus has gradually developed into an important vector system. [0003] Adenovirus vectors are characterized by high transgene efficiency, in vitro experiments usually have a transduction efficiency of more than 90%; they can transduce different types of human tissue cells, regardless of whether the target cells are dividing cells; they do not integrate into cells The host cell genome is only expressed transiently, with high safety. Therefore, adenoviral vectors ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/861C12N7/01
Inventor陈海旭叶军
Owner上海诺百生物科技有限公司