Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Activating tag Ac/Ds transposons system and application thereof in building of plant mutant library

A technology for activating tags and transposons, which is applied in the field of plant genetic engineering, can solve the problems of difficult genetic transformation technology and heavy workload, and achieve the effect of overcoming recessive mutations and avoiding artificial transgenic operations

Inactive Publication Date: 2013-09-18
SOUTHWEST UNIVERSITY
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As mentioned above, T-DNA-based activation labeling technology requires a lot of heavy tissue culture transformation work to obtain tens of thousands of transgenic plants. It is even more difficult for crops

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Activating tag Ac/Ds transposons system and application thereof in building of plant mutant library
  • Activating tag Ac/Ds transposons system and application thereof in building of plant mutant library
  • Activating tag Ac/Ds transposons system and application thereof in building of plant mutant library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1. Construction of Ac transposase plant expression vector

[0045] 1. The amplification primer sequence of the Ac transposase gene is:

[0046] Reverse primer: TCATGGAGAGGAGCCACTTGC

[0047] Forward primer: AAACCGCGGATGACGCCTCCGGTTGGAAAT

[0048] 2. PCR amplification reaction system: the reaction system with a total volume of 50ml contains 5.0ml of 10×buffer, 1.0ml of 10mM dNTPs, 0.5ml of 10mM forward and reverse primers, 1ml of plasmid template, 2ml of Pfu DNA polymerase, and no Bacteria double distilled water 40ml;

[0049] 3. PCR amplification reaction conditions: melting at 94°C for 5 min; 30 cycles of 94°C for 40 s, 58°C for 40 s, and 72°C for 5 min; extension at 72°C for 5 min;

[0050] 4. Purification of PCR products: After PCR amplification, the products are directly purified with the DNA recovery kit of Dingguo Biotech Co., Ltd., and purified according to the operating instructions;

[0051] 5. Enzyme digestion of PCR products: a reaction syste...

Embodiment 2

[0069] Example 2. Construction of transposon (Ds) vector with activation tag

[0070] 1. Construct the transposon element containing the pBSK vector inside:

[0071] (1)-(8) of this implementation process connected the 5' end of the transposon element to a section of the pBSK vector, and (9)-(18) connected the 3' end of the transposon element to the pBSK vector Another segment, and finally a transposon element containing the pBSK vector inside.

[0072] (1) PCR amplification of the 5' fragment of the transposon element: the forward primer is AGCTTGATATCGAATTCCTGC, the reverse primer is AAACTCGAGCGGCGGTACCCCGCGC, the amplification template is the plasmid vector Ds Launch Pad T-DNA vector, and the amplification system is the same as in Example 1-2; Amplification reaction conditions: melting at 94°C for 5 min; 30 cycles of 94°C for 40 s, 58°C for 40 s, and 72°C for 2 min; extension at 72°C for 5 min; after that, the PCR product was purified and recovered, and the purification ...

Embodiment 3

[0126] Example 3. Agrobacterium transformation of plasmid DNA

[0127] 1. Materials and reagents:

[0128] Agrobacterium LBA4404;

[0129] YEB medium (1 liter): beef extract 5g, yeast extract 1g, tryptone 5g, MgSO4 7H 2 O 0.5g, add 800 ml of distilled water to adjust the pH to 7.0, constant volume (solid medium plus 1.5% agar powder), aliquot and autoclave.

[0130] 1. Preparation of Agrobacterium Competent: Pick a single colony of LBA4404 and inoculate it into 5ml bacterial solution (containing rifampicin at a concentration of 50mg / ml), and cultivate overnight; ml); 28°C, 200rpm culture to OD600=0.6-0.8; ice bath for 20 minutes, 5000rpm, 4°C, centrifuge for 15 minutes to collect the bacteria; suspension in 10% glycerol of equal volume; collect the bacteria as above, 1 / 2 volume 10 % glycerol suspension, repeat once; collect bacteria, suspension in glycerol prepared by 50ml ultrapure water; collect bacteria, suspension in 10% glycerol prepared by 1ml ultrapure water; 100ml...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an activating tag Ac / Ds transposons system. The system consists of a transposase Ac expression vector and a transposons Ds expression vector. The system is characterized in that the transposons Ds expression vector is provided with an activating tag, the activating tag refers to four 35S enhansers which are connected with one another in series, and the four 35S enhansers are arranged at the inner side of the Ds 3'end. After the Ac / Ds transposons system provided by the invention is used, an Ac transposons gene can be expressed in a plurality of plants at a high level, the expression level of a transposons insertion site which is near to the gene can be activated at the high level, a dominant mutant can be created, and the flanking sequence of the transposons insertion site can be identified and separated with high efficiency for building a mutant library of a polyploid plant. The activating tag Ac / Ds transposons system provided by the invention is an ideal plant functional genomics research tool, and has an important meaning on building the mutant of crops especially for the polyploid plant, and researching the functional genomics.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and specifically relates to the construction of the novel activation tag Ac / Ds transposition system and its application in the creation of plant mutant libraries. Background technique [0002] With the completion of genome-wide sequencing of various plants, the era of plant post-genomics, which aims to seek gene functions, has arrived. Facing the massive data and resources generated in these genome sequencing work, how to discover new genes, understand gene functions and understand how all genes coordinate and function during plant growth and development has become the most urgent task for functional genomics research. To accurately understand the function of each gene and the interaction between genes, it is necessary to analyze the mutant phenotype of a single gene and multiple genes, and analyze and identify the gene function through the mutant phenotype. The most direct and effective...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66A01H5/00A01H1/02
Inventor 张洪博王文静刘贯山马浩然
Owner SOUTHWEST UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com