Activating tag Ac/Ds transposons system and application thereof in building of plant mutant library
A technology for activating tags and transposons, which is applied in the field of plant genetic engineering, can solve the problems of difficult genetic transformation technology and heavy workload, and achieve the effect of overcoming recessive mutations and avoiding artificial transgenic operations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Embodiment 1. Construction of Ac transposase plant expression vector
[0045] 1. The amplification primer sequence of the Ac transposase gene is:
[0046] Reverse primer: TCATGGAGAGGAGCCACTTGC
[0047] Forward primer: AAACCGCGGATGACGCCTCCGGTTGGAAAT
[0048] 2. PCR amplification reaction system: the reaction system with a total volume of 50ml contains 5.0ml of 10×buffer, 1.0ml of 10mM dNTPs, 0.5ml of 10mM forward and reverse primers, 1ml of plasmid template, 2ml of Pfu DNA polymerase, and no Bacteria double distilled water 40ml;
[0049] 3. PCR amplification reaction conditions: melting at 94°C for 5 min; 30 cycles of 94°C for 40 s, 58°C for 40 s, and 72°C for 5 min; extension at 72°C for 5 min;
[0050] 4. Purification of PCR products: After PCR amplification, the products are directly purified with the DNA recovery kit of Dingguo Biotech Co., Ltd., and purified according to the operating instructions;
[0051] 5. Enzyme digestion of PCR products: a reaction syste...
Embodiment 2
[0069] Example 2. Construction of transposon (Ds) vector with activation tag
[0070] 1. Construct the transposon element containing the pBSK vector inside:
[0071] (1)-(8) of this implementation process connected the 5' end of the transposon element to a section of the pBSK vector, and (9)-(18) connected the 3' end of the transposon element to the pBSK vector Another segment, and finally a transposon element containing the pBSK vector inside.
[0072] (1) PCR amplification of the 5' fragment of the transposon element: the forward primer is AGCTTGATATCGAATTCCTGC, the reverse primer is AAACTCGAGCGGCGGTACCCCGCGC, the amplification template is the plasmid vector Ds Launch Pad T-DNA vector, and the amplification system is the same as in Example 1-2; Amplification reaction conditions: melting at 94°C for 5 min; 30 cycles of 94°C for 40 s, 58°C for 40 s, and 72°C for 2 min; extension at 72°C for 5 min; after that, the PCR product was purified and recovered, and the purification ...
Embodiment 3
[0126] Example 3. Agrobacterium transformation of plasmid DNA
[0127] 1. Materials and reagents:
[0128] Agrobacterium LBA4404;
[0129] YEB medium (1 liter): beef extract 5g, yeast extract 1g, tryptone 5g, MgSO4 7H 2 O 0.5g, add 800 ml of distilled water to adjust the pH to 7.0, constant volume (solid medium plus 1.5% agar powder), aliquot and autoclave.
[0130] 1. Preparation of Agrobacterium Competent: Pick a single colony of LBA4404 and inoculate it into 5ml bacterial solution (containing rifampicin at a concentration of 50mg / ml), and cultivate overnight; ml); 28°C, 200rpm culture to OD600=0.6-0.8; ice bath for 20 minutes, 5000rpm, 4°C, centrifuge for 15 minutes to collect the bacteria; suspension in 10% glycerol of equal volume; collect the bacteria as above, 1 / 2 volume 10 % glycerol suspension, repeat once; collect bacteria, suspension in glycerol prepared by 50ml ultrapure water; collect bacteria, suspension in 10% glycerol prepared by 1ml ultrapure water; 100ml...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap