Glycosyltransferase gene and application thereof

A technology of glycosyltransferase and gene, which is applied in the field of genetic engineering to achieve the effect of reducing production cost and simplifying the production process

Inactive Publication Date: 2014-09-24
SUN YAT SEN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In recent years, metagenomics has made remarkable progress in the study of new biocatalysts. Researchers have used metagenomics technology to screen There are many biocatalysts with industrial application potential, such as lipase / esterase, amylase, xylanase, cellulase, β-glucosidase, but so far, there is no There are reports of using glycosyltransferases to synthesize galacto-oligosaccharides from lactose and obtaining glycosyltransferases from marine samples by metagenomic technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glycosyltransferase gene and application thereof
  • Glycosyltransferase gene and application thereof
  • Glycosyltransferase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Construction of marine silt metagenomic library and screening of positive clones

[0043] (1) Extraction of genomic DNA from marine sludge samples: Weigh 5 g of sample into a 50 mL centrifuge tube, add 13.5 mL

[0044] DNA extraction buffer, vigorously shake and mix, then add 100 μL proteinase K (10 mg / ml), invert repeatedly 5-6 times, then place in 37 °C water bath for 30 min, then add 1.5 mL 20% SDS, 65 °C water bath for 2 After centrifugation at 6,000 g for 10 min (upside down several times every 15 min), take the supernatant, extract twice with an equal volume of chloroform, centrifuge at 10,000 g for 20 min, take the supernatant, and add 0.6 times the volume of isopropyl Alcohol, left at room temperature for 1 h, centrifuged at 16,000 g for 20 min, discarded the supernatant, added 5 mL of pre-cooled 70% ethanol, centrifuged at 16,000 g for 5 min to collect the DNA precipitate, air-dried and dissolved with appropriate amount of TE buffer.

[0045] T...

Embodiment 2

[0056] Example 2 Glycosyltransferase gene Glyt7-2 Expression in E. coli

[0057] (1) PCR amplification of the glycosyltransferase gene: design primers according to the sequence of the above glycosyltransferase gene, and introduce a gene that can be inserted into the expression vector pET32a (+) (Novagen) Eco R I and Hin d III double restriction site, the primer sequence is as follows:

[0058] Glyt7-2 F: TGGCACCCGAATTCATGCGGATCGCGTTCCATAAGC

[0059] Glyt7-2 R: CCGTCGATAAGCTTTCATGCCGCGCCAATTGGGAAG

[0060] The extracted recombinant plasmid pUC19?lacZ– Glyt7-2 As a template, the above primers are used to carry out PCR amplification reaction, and the system is as follows:

[0061] pUC19?lacZ– Glyt7-2 template 5 ng 5×Buffer 1 μl dNTPs (2.5 mM) 4 μl Glyt7-2 F (20 μM) 1 μl Glyt7-2 R (20 μM) 1 μl PrimerSTAR (2.5 U / μl) 0.5 μl Make up to 50 μl with water

[0062] The PCR reaction conditions are as follows...

Embodiment 3

[0071] Example 3 Preparation and Purification of Recombinant Glycosyltransferase Glyt7-2 Crude Enzyme Solution

[0072] Inoculate the recombinant strains preserved in Example 2 in LB liquid medium containing 100 μg / ml ampicillin, and culture with vigorous shaking at 37°C until OD 600 =0.6~1.0, add the final concentration of 0.1~1.2 mM (IPTG), induce expression at 18~37 ℃ for 6~14 h, collect the bacteria, crush and centrifuge to obtain the crude enzyme solution. The crushed crude enzyme solution was purified with His·Bind Purification Kit (Novagen) and operated according to the instructions. SDS–PAGE electrophoresis analysis showed (attached figure 1 ), the purified recombinant glycosyltransferase is a single band with a molecular weight of about 64.5 kDa (of which 18 kDa is the fusion protein tag on the expression vector), which is consistent with the theoretically predicted protein molecular weight (46.5 kDa).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a glycosyltransferase gene. The gene is derived from a marine silt metagenomic library. The nucleotide sequence of the gene is 1332 bases long and encodes 443 amino acids. The nucleotide sequence and amino acid sequence are as follows: Shown in SEQ ID NO.1 and SEQ ID NO.2. The gene can be efficiently and solublely expressed in the E. coli expression system, and the enzymatic properties of the recombinant enzyme expressed by the gene are: with o-nitrophenol-β-D-galactoside as the substrate, the optimal reaction temperature of the enzyme It is 45°C, the optimum pH is 7.0, and it has good stability below 45°C and within the range of pH6.0~8.0. The recombinant glycosyltransferase not only has high transglycosylation activity, but also has glycosidic bond hydrolysis activity, and reacts under the conditions of 30% (w / v) lactose solution as substrate, pH 7.0, 40°C 12h, the yield of galacto-oligosaccharides was as high as 49.47%.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a new gene of a glycosyltransferase, in particular to the application of the glycosyltransferase in biological preparation of galacto-oligosaccharides. Background technique [0002] Functional oligosaccharides have become important functional food ingredients because of their unique physiological functions, and have attracted worldwide attention. In recent years, people's demand for health food such as functional oligosaccharides is increasing. Galacto-oligosaccharides (GOS), also known as oligosaccharides, is a naturally occurring functional oligosaccharide, and it is also one of the most widely recognized and safest oligosaccharides among many functional oligosaccharides , which is a type of low-polymerized sugar formed by linking 1 to 9 galactose residues on the galactose or glucose side of the lactose molecule. Galactooligosaccharides have health functions s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P19/18C12R1/19
Inventor 刘玉焕汪思迪李良曹立创童铃郭耿珊
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap