Nucleic acid detection method combining RNA amplification with hybrid capture method
A detection method, nucleic acid technology, applied in the direction of microbial determination/inspection, biochemical equipment and methods, etc., can solve problems such as deficiencies, and achieve the effects of avoiding pollution, stable biotin-labeled probes, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1. Detection of Human Respiratory Syncytial Virus RSV: Using the method of coating a solid phase with a specific antibody that recognizes DNA / RNA hybrids
[0029] 1. Design and synthesis of primers and detection probes:
[0030] According to the F gene sequence of RSV in genebank, the sequences of primers and detection probes were designed as follows:
[0031] Primer 1: GTGGTAATTGTACTACATATGCTAAG (SEQ ID No 1)
[0032] Primer 2: TAATACGACTCACTATAGGGAGAATGCAGGTGTAACTACACCTGTAAG (SEQ ID No 2)
[0033] Detection probe 1: Biotin-ATCATTGATTAATGAT (SEQ ID No 3)
[0034] Detection probe 2: Biotin-TTAACATATAAGTGCT (SEQ ID No 4)
[0035] 2. Pre-coating: Coat the antibody that specifically recognizes DNA / RNA hybrids on a microwell plate at a concentration of 1:1000, add fixative, fix for 2 hours, and then air-dry at room temperature.
[0036] 3. Sample collection and pretreatment:
[0037] 1) Collect the patient's nasopharyngeal swab sample: let the patient's head be...
Embodiment 2
[0054] Nucleic acid detection of eight respiratory pathogens: using streptavidin-coated solid phase
[0055] Simultaneously detect eight respiratory pathogens in the samples to be tested (nasopharyngeal swabs, etc.), including influenza A virus (FLUA), influenza B virus (FLUB), human parainfluenza virus (PIV), adenovirus (AdV), human Rhinovirus (HRV), Respiratory Syncytial Virus (RSV), Mycoplasma pneumoniae (MP), Chlamydia pneumoniae (Cpn). The amplification buffer contains primers for 8 kinds of pathogens, which can simultaneously amplify 8 kinds of pathogens that may exist in a sample through one reaction. During the detection, the sample is divided into 8 parts for hybridization, and the corresponding detection of a single pathogen is used respectively. The probes are hybridized and identified, and finally realize the high-throughput detection of 8 pathogens in a single sample.
[0056] 1. Design and synthesis of primers and detection probes:
[0057] According to the spe...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com