High-stereoselectivity esterolytic enzyme, encoding gene and application of encoding gene

A stereoselective, ester hydrolase technology, applied in the fields of hydrolase, application, genetic engineering, etc., can solve complex, high cost, difficult to adopt and other problems, and achieve the effect of high stereoselectivity and high catalytic activity

Active Publication Date: 2014-05-28
ZHEJIANG UNIV OF TECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To solve this problem, the occurrence of side reactions can be reduced by means of engineering regulation, and a single enzyme preparation can be obtained by separation and purification to catalyze the reaction. However, these processes are often complicated and costly, and are not easy to be used in reproduction.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-stereoselectivity esterolytic enzyme, encoding gene and application of encoding gene
  • High-stereoselectivity esterolytic enzyme, encoding gene and application of encoding gene
  • High-stereoselectivity esterolytic enzyme, encoding gene and application of encoding gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Cloning of the BCEST gene from Bacillus cereus

[0032] Degenerate primers 1 and 2 were designed according to the genome DNA sequence of Bacillus cereus ATCC10876 (GenBank: ACLT01000051.1).

[0033] Primer 1 sequence: TCTAAAATTGAAACACCTGTTATG

[0034] Primer 2 sequence: TTATTTAATTTTCTTAAATGTAAGC

[0035]The genomic DNA of Bacillus cereus CCTCC M2012403 was used as a template for PCR amplification (using Takala kit). The PCR reaction system and reaction conditions are shown in Tables 1 and 2. Steps 2 to 4 are repeated 29 times.

[0036] Table 1: PCR amplification reaction system

[0037]

[0038] Table 2: PCR amplification reaction conditions

[0039]

[0040]

[0041] The PCR amplification product was detected by 0.8% agarose gel electrophoresis, and the product was a single band with a size of about 1500bp (such as figure 1 shown). Purify and recover the PCR product. For specific steps, refer to the instructions of the Beijing Biotech Genomic ...

Embodiment 2

[0042] Embodiment 2: Construction of expression vector and transformant

[0043] A-T ligation of the target fragment with the pEASY-E1 expression vector, the ligation system is as follows in Table 3:

[0044] Table 3: Connection system of pEASY-E1Expression Vector

[0045]

[0046] Mix gently and react at room temperature for 5 min. The ligation product was transformed into 50 μL of primary melted Trans1-T1 competent cells. PCR method to identify positive recombinants in the correct expression direction (such as figure 2 shown), transferred to LB medium to amplify the vector. The recombinant plasmid pEASY-E1-BCEST was extracted from Trans1-T1 cells with TaKaRa plasmid extraction kit, transformed into E.coli BL21(DE3) competent cells, and positive clones were obtained by screening with Amp-resistant medium and identified by PCR cloning. Containing the correct recombinant plasmid, thereby obtaining a transformant—a genetic engineering strain E.coliBL21(DE3) / pEASY-E1-BCES...

Embodiment 3

[0047] Embodiment 3: Expression of recombinant ester hydrolase

[0048] The genetically engineered strain E.coli BL21(DE3) / pEASY-E1-BCEST was inoculated into 50 mL of LB medium containing 80 μg / mL ampicillin, and cultured overnight at 37° C. with shaking. Take 1 mL of the culture solution and connect it to 50 mL of fresh LB medium containing 80 μg / mL ampicillin, culture to about OD600=0.6, add IPTG to its concentration of 0.2 mmol / L for induction, and continue to culture for 8 h. Bacteria were collected by centrifugation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides high-R-isomer-stereoselectivity esterolytic enzyme, an encoding gene of the esterolytic enzyme, a carrier containing the encoding gene, an engineering bacterium and application of the encoding gene. An amino acid sequence of the esterolytic enzyme is shown as SEQ ID No.2, and a nucleotide sequence of the encoding gene is shown as SEQ ID No.1. The esterolytic enzyme provided by the invention has higher catalysis activity and stereoselectivity, and can be used for preparing an optically pure chiral compound, particularly a levetiracetam intermediate, namely alpha-ethyl-2-oxygen-1-pyrrolidine methyl acetate.

Description

(1) Technical field [0001] The invention relates to a highly stereoselective ester hydrolase and its encoding gene, as well as a carrier containing the encoding gene, engineering bacteria and application thereof. (2) Background technology [0002] Ester hydrolases include lipase and esterase, which are a class of biocatalysts with important uses in chiral synthesis. These enzymes can recognize a wide range of substrates. At present, more than 40% of biological object synthesis reactions can be catalyzed by ester hydrolases. These reactions have the characteristics of mild conditions, high regioselectivity and high stereoselectivity. It has been widely used in enzymatic kinetic resolution of racemic esters, amines and conversion of pre-chiral alcohols. In addition, they can be used in selective esterification, transesterification and polymerization reactions. [0003] Due to the increasing demand for chiral drugs and intermediates, the use of biological or enzymatic synthes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/18C12N15/55C12N15/70C12N1/21C12P41/00C12P7/62C12R1/19
CPCC12N9/18C12P7/62C12P41/001
Inventor汪钊郑建永应向贤章银军
OwnerZHEJIANG UNIV OF TECH