A recombinant Pichia pastoris strain co-expressing exo-inulinase and endonuclease and its construction method and application
A technology of exo-inulinase and Pichia pastoris, which is applied in the field of genetic engineering and fermentation engineering, can solve the problems of unsuitable industrial application, difficulty in large-scale cultivation, low enzyme activity, etc., achieve good genetic stability, and is fully feasible The effect of improving the efficiency and enzyme digestion efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Construction of recombinant Pichia pastoris GS115-INU1 expressing exo-inulinase INU1
[0038] 1. Construction of recombinant plasmid pPIC9-INU1
[0039] 1.1 Genome extraction
[0040] The genome of Kluyveromyces marxianus CGMCC2.1440 was extracted with a yeast genomic DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.). For specific preparation methods, refer to the operation manual of the kit.
[0041] 1.2 Cloning of gene INU1
[0042] Use the genome extracted in 1.1 as a template for the PCR reaction, and design a pair of primers based on the known exinulinase gene sequence on NCBI:
[0043] INU1-XhoI upstream:
[0044] GCCCG CTCGAG AAAAGAGAGGCTGAAGCTAGAGATGGTGACAGCAAGGCC
[0045] (The underlined part is the XhoI restriction site);
[0046] Downstream of INU1-AvrII:
[0047] GCCCG CCTAGG ATGGTGGTGATGGTGGTGAACGAACGTTACCCAATTTAACG
[0048] (the underlined part is the AvrII restriction site),
[0049] A PCR reactio...
Embodiment 2
[0084] Example 2 Construction of recombinant Pichia pastoris GS115-INU1-INU2 expressing exo-inulinase INU1
[0085] 1. Construction of recombinant plasmid pPIC9K-INU2
[0086] 1.1 Genome extraction
[0087]The genome of Aspergillus ficuum CGMCC3.4322 was extracted with BiospinFungusGenomicDNAExtraction Kit (BioerTechnologyco., Ltd.). For the specific preparation method, refer to the operation manual of the kit.
[0088] 1.2 Cloning of gene INU2
[0089] Use the genome extracted in 1.1 as a template for the PCR reaction, and design a pair of primers based on the known endinulinase gene sequence on NCBI:
[0090] INU2-EcoRI upstream:
[0091] ACGC GAATTC CAGTCTAATGATTACCGTCCTT (the underlined part is the EcoRI restriction site);
[0092] Downstream of INU2-NotI:
[0093] ATA GCGGCCGC TCATTCAAGTGAAACACTCC (the underlined part is the NotI restriction site),
[0094] A PCR reaction was performed to clone INU2. PCR amplification conditions: pre-denaturation at 94°C for 2m...
Embodiment 3
[0127] Embodiment 3 utilizes the method for expressing inulinase in large quantities by high-density fermentation of Pichia pastoris (Pichia pastoris) GS115-INU1-INU2 bacterial strain described in the present invention
[0128] The main instruments used in this method are:
[0129] Fermenter Labfors5 (3.6L): purchased from Iverson Biotechnology Co., Ltd.
[0130] The specific plan is as follows:
[0131] Inoculate the transformant GS115-INU1-INU2 into 100ml of YPD medium, and shake the flask to culture to bacterial concentration OD 600 The value is 4-6, and the inoculation amount of 10% by volume is received in a 3L fermenter equipped with 1.2LBSM basic salt medium, and fed-batch culture is carried out. During the fermentation process, ammonia water is added to adjust the pH value, the ventilation volume is maintained at 1-3vvm, and the rotation speed is 400-900r / min.
[0132] Bacteria growth stage: temperature is set at 30°C, pH is 4.5, and dissolved oxygen is kept above 1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
