Vector comprising glucose promoter, host bacterium and preparation method of recombinant bovine-derived trypsinase

A technology of glucose promoter and bovine trypsin is applied in the preparation field of a carrier containing a glucose promoter, host bacteria and recombinant bovine trypsin, which can solve the problems such as the inability to completely remove other proteins, and achieves small size, high-efficiency expression, purifying simple effects

Inactive Publication Date: 2014-12-10
BEIJING AMBITION BIOTECH
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are two main methods for preparing trypsin: one is to extract pancreas from animals such as pigs and cattle, which is widely used because of its relatively simple method, but this method cannot completely remove other proteins, and the animal source in the product Viruses such as foot-and-mouth disease virus and mad cow disease virus cannot be completely removed, so there are certain limitations and risks in their application. Laihe Jiangsu Wanbang patents for inclusion body renatured bovine trypsin expressed by Escherichia coli and hybrid bovine trypsin fermented by Pichia pastoris by India Baikang

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector comprising glucose promoter, host bacterium and preparation method of recombinant bovine-derived trypsinase
  • Vector comprising glucose promoter, host bacterium and preparation method of recombinant bovine-derived trypsinase
  • Vector comprising glucose promoter, host bacterium and preparation method of recombinant bovine-derived trypsinase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Extraction of Pichia pastoris genome and amplification of PG6 promoter

[0056] 1. Streak PichiapastorisX33 onto YPD solid medium, culture at 30°C for 2 days, pick a single colony and inoculate it into YPD liquid medium, and after culturing for 1 day, extract the genome according to the instructions of Tiangen Yeast Genome Kit.

[0057] 2. Use the genome extracted in step 1 as a template, and use the designed two primers as upstream and downstream primers to amplify the PG6 promoter.

[0058] PG6-F: CGAAGATCTAGACCAGCAGTTTAACTACG (the underline is BglII restriction enzyme)

[0059] PG6-R: CCTGCCTTCGAACTTTTCTTTGGGCAAGGAAA (the underline is BstBI restriction enzyme)

[0060] PCR reaction system:

[0061] components

Volume (uL)

10×TransTaqHiFiBufferI

5

dNTPs (2.5mM)

4

Upstream primer PG6-F (10uM)

2

Downstream primer PG6-R (10uM)

2

DNA polymerase TaqHiFi (5U / uL)

0.5

PichiaX33 genome

1 ...

Embodiment 2

[0066] Embodiment 2 Transformation of pPICZαB vector

[0067] Digest pPICZαB with BglII and BstBI, recover a fragment of about 2700 bp, connect the 2700 fragment with the PG6 product in Example 1 with BglII and BstBI, and then use T4DNAligase, named: ZαB-PG6, the connection system is as follows:

[0068] components

[0069] The ligation product was transformed into TOP10, the positive clones were screened by colony PCR, and the positive clones were identified by plasmid digestion and sent to Jinweizhi for sequencing.

Embodiment 3

[0070] Example 3 Construction of bovine trypsin (BovineTrypsin, BT) former expression plasmid using ZαB-PG6

[0071] The nucleotide sequence encoding bovine trypsinogen was chemically synthesized according to the codon preference of Pichia pastoris, and the final nucleotide sequence was the nucleotide sequence shown in SEQ NO:2.

[0072] The reaction primer sequence is:

[0073] Upstream primer ZαB-BT-F:

[0074] AAGCTCGAGAAAAGATTTCCAGTTGATGATGATGATAAGATT (the XhoI recognition site is underlined)

[0075] Downstream primer ZαB-BT-R:

[0076] ATATAGCGGCCGCGTTAGAAGCAATAGTTTGCTTAATCC (the underline is the NotI recognition site)

[0077] Use the above primers to amplify the BT sequence with XhoI and NotI restriction sites, purify the PCR product with an agarose gel recovery kit, and double-enzyme ZαB-PG6 and PCR product with XhoI and NotI, respectively. The fragments were ligated with T4DNAligase, named: ZαB-PG6-BT, and the ligation system was as follows:

[0078] co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Enzyme activityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a method for expressing a bovine-derived trypsinogen gene in Pichia pastoris by gene recombination. The recombinant bovine trypsinogen is expressed in Pichia pastoris by the novel promoter and secreted into the culture medium; the zymogen is self-activated, or treated by enterokinase or trypsinase or the like to prepare the active bovine trypsinase; and the prepared active bovine trypsinase can be used for producing the recombinant human insulin and human insulin analogs. The method can avoid the defects in the constitutive promoter glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter and the induction-type promoter alcohol oxidase (AOX1) promoter.

Description

technical field [0001] The invention relates to a genetically engineered bacterium for recombinantly expressing bovine trypsin, a construction method and application thereof. Specifically, it relates to a construction method and application of a genetically engineered bacterium that uses a novel promoter to promote the expression of bovine trypsin. Background technique [0002] Trypsin (TRYPSIN, EC3.4.21.4) functions as a digestive enzyme in vertebrates. Trypsin is an endopeptidase secreted by the pancreas. The initial secretion is trypsinogen, which is decomposed into activated trypsin by the restriction of enterokinase or trypsin, which is an endopeptidase. Mainly acts on the peptide bond at the carboxy terminus of arginine or lysine. It not only acts as a digestive enzyme, but also restricts and decomposes the precursors of other enzymes such as chymotrypsinogen, carboxypeptidase, and phospholipase, and activates them. It is the most specific protease, and it becomes a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12N9/76C12R1/84
Inventor王晓霞彭毅
OwnerBEIJING AMBITION BIOTECH