Ketoreductase mutant for producing (S)-4-chloro-3-hydroxy ethyl butyrate

A technology of ethyl hydroxybutyrate and reductase, which is applied in the directions of oxidoreductase, microorganism-based method, and introduction of foreign genetic material using a carrier, which can solve the harsh conditions of chemical synthesis process, the difficulty of product separation and purification, and the catalytic activity. Low problems, to achieve the effect of low equipment requirements, high specific enzyme activity, and convenient purification

Active Publication Date: 2015-02-11
NANJING LANGEN BIOLOGICAL SCI & TECH
View PDF5 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to harsh conditions in the chemical synthesis process, many side reactions, difficult separation and purification of products, low yield and high cost, it is difficult to become an ideal method for commercial scale synthesis
Enzymatic preparation and chiral (S)-4-chloro-3-hydroxy-butyric acid ethyl ester require the use of a stereoselective ketoreductase, but the existing wild-type ketoreductase has a very low catalytic activity. 10g / L crude enzyme powder can only convert 1g / L of ketone substrate in 20 hours, which also makes it difficult to be an ideal method for commercial scale synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Constructing wild-type and ketoreductase mutant engineering bacteria

[0024]After the polynucleotide (SEQ ID NO: 1) encoding the wild-type ketoreductase from Lactobacillus kefir (Lactobacillus kefir) was sequence optimized according to the codon preference of strain DH1 (see Puigbò P, Guzmán E, Romeu A , Garcia-Vallvé S. OPTIMIZER: a web server for optimizing the codon usage of DNA sequences. Nucleic Acids Res. 2007), through PCR-based gene synthesis method (PCR-based gene synthesis method) for gene synthesis. The optimized polynucleotide encoding ketoreductase was cloned under the control of the promoter of the expression vector (SEQ ID NO. 5) to obtain a plasmid capable of expressing wild-type ketoreductase. The resulting plasmid was transformed into E. coli DH1 by standard methods. The cloning method used is homologous recombination, and the amplification primers used are:

[0025] F: 5' ATTAAAGAGGAGAAATTAACATATGACTGATCGTTTAAAAGGCAAAG 3';

[0026] R: 5'...

Embodiment 2

[0028] Example 2 Preparation of ketoreductase

[0029] Pick a single colony of Escherichia coli DH1 containing the target expression vector and inoculate it in 10ml of high-pressure sterilized medium: tryptone 10 g / L, yeast extract 5 g / L, disodium hydrogen phosphate 3.55 g / L, diphosphate Potassium hydrogen 3.4 g / L, ammonium chloride 2.68 g / L, sodium sulfate 0.71 g / L, magnesium sulfate heptahydrate 0.493 g / L, ferric chloride hexahydrate 0.027 g / L, glycerin 5g / L, glucose 0.8g / L L, add ampicillin to 100mg / L after sterilization. Cultivate overnight at 30°C, 250rpm. The next day, take a 1L Erlenmeyer flask and inoculate it into 100ml of autoclaved medium at a ratio of 1:100: tryptone 10 g / L, yeast extract 5 g / L, disodium hydrogen phosphate 3.55 g / L , potassium dihydrogen phosphate 3.4 g / L, ammonium chloride 2.68 g / L, sodium sulfate 0.71 g / L, magnesium sulfate heptahydrate 0.493 g / L, ferric chloride hexahydrate 0.027 g / L, glycerin 5g / L, glucose 0.3g / L. Add kanamycin to 50mg / L af...

Embodiment 3

[0031] Example 3 Determination of Ketoreductase Activity

[0032] Since NADPH has an absorption peak at 340nm, while NADP has no absorption peak at 340nm, the activity of ketoreductase can be calculated by detecting the change of NADPH absorbance value during the reaction. The ketoreductase activity assay system is as follows: take 100ul of an appropriate concentration of enzyme solution and add it to a final concentration of 100mM pH7.0 triethanolamine buffer solution, 1g / L NADP, 50% isopropanol, 1mM magnesium sulfate reaction system for reaction. Before adding the enzyme solution, the reaction system needs to be thoroughly mixed and placed in a 25°C water bath. After diluting the dry ketoreductase powder prepared in Embodiment 2 in an appropriate ratio, take 100ul and add it into the reaction system, mix well and detect the change value of absorbance per minute at 340nm. The enzymatic activity of ketoreductase was calculated with reference to the NADPH standard curve. Unit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a ketoreductase mutant deriving from wild type ketoreductase of lactobacillus kefir. The ketoreductase mutant is capable of converting ethyl-4-chloroacetoacetate to generate (S)-4-chloro-3-hydroxy ethyl butyrate and has one or multiple of mutations in A94S, F147V, L199P and A202V. The ketoreductase mutant provided by the invention has obvious high specific enzyme activity which is improved by 2-20 times in comparison with the wild type ketoreductase; the enzyme can be used for biologically catalyzing to convert the ethyl-4-chloroacetoacetate to generate (S)-4-chloro-3-hydroxy ethyl butyrate; the reaction condition is mild, and the requirement on equipment is low, the production process is free from high temperature or cooling, and the energy consumption is low; since the enzyme catalysis is efficient and unique in selectivity, the method can be used for producing statins key intermediate (S)-4-chloro-3-hydroxy ethyl butyrate without producing byproduct, and the purification is convenient; in addition, the vast majority solvent in the reaction is water, the three-waste emission is low, and the ketoreductase mutant is environmental friendly.

Description

technical field [0001] The invention relates to a ketoreductase mutant and its application in the production of statin drug intermediates, in particular to a ketoreductase mutant derived from Lactobacillus kefir and its use in chiral (S) - Application in the production of ethyl 4-chloro-3-hydroxy-butyrate. Background technique [0002] Atorvastatin calcium (trade name LIPITOR sold by Pfizer), rosuvastatin calcium (trade name CRESTOR sold by AstraZeneca) and pitavastatin (trade name Lipalo sold by Nissan Chemical and Kowa in Japan), Is an important cholesterol-lowering statin drugs. Chiral (S)-4-chloro-3-hydroxy-butyric acid ethyl ester is the key chiral intermediate of these important statins. The domestic production of this intermediate in 2009 was 400 tons, and it is expected that in the next few years, the domestic production will reach more than 1,000 tons, and the direct economic benefits will be several hundred million yuan. The many routes known to prepare these ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/62C12R1/225
CPCC12N9/0006C12P7/62
Inventor丁雪峰
OwnerNANJING LANGEN BIOLOGICAL SCI & TECH