Acidic beta-glucanase NGlu as well as gene and application thereof

A glucanase and gene technology, which is applied in the fields of genetic engineering and fermentation engineering, can solve the problems of difficulty in filtering wort and beer, reduce the quality of beer, affect the stability of beer, etc., and achieve good digestion ability against pepsin and trypsin. , excellent stability and temperature resistance, and the effect of obvious market competitive advantage

Active Publication Date: 2015-06-17
JIANGSU YINONG BIOLOGY CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0012] Barley is used in beer production, and the content of β-glucan is as high as 4%-8%. The β-glucan in barley will increase the viscosity of wort during saccharification, and it is easy to absorb high molecular substances such as protein. It causes "hardening" of wheat grains, which makes it difficult to filter wort and beer, and reduces the yield of wort; in addition, barley β-glucan cannot be used or decomposed by yeast, which can easily cause beer turbidity and gel precipitation, affecting the stability of beer Sexuality, reduce the quality of beer, the residue of β-glucan will cause the beer body to be turbid, the foam persistence will be reduced and the glass hanging force will not be strong

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acidic beta-glucanase NGlu as well as gene and application thereof
  • Acidic beta-glucanase NGlu as well as gene and application thereof
  • Acidic beta-glucanase NGlu as well as gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1. Fermentation culture and enzymatic property test of Aspergillus niger strain producing β-glucanase

[0058] The Aspergillus niger strain AN0803 adopted in the present invention has undergone single and compound mutagenesis treatments such as ultraviolet rays, nitrosoguanidine, diethyl sulfate (DES), high-energy ion beams, etc. before use, and can produce α-galactobacter Enzymes such as glycosidase, β-glucanase, β-mannanase, etc.

[0059] The mutant strain AN0803 was fermented and cultured, and the composition of the fermentation medium was as follows:

[0060] 0.5% peptone, 2% soybean flour, 2% wheat flour, 0.5% glucose, 0.25% potassium dihydrogen phosphate, 0.10% magnesium sulfate, natural pH.

[0061] The preparation of the above liquid fermentation culture is based on sterilization at 121°C and 0.1MPa for 30 minutes. After cooling, it is inoculated with Aspergillus niger AN0803 strain, and cultured at 30°C and 200rpm for 4 days.

[0062] After the fermen...

Embodiment 2

[0063] Embodiment 2, cloning of Aspergillus niger (Aspergillus niger) β-glucanase gene

[0064] Use the RNA extraction kit to extract the total RNA of the Aspergillus niger mutant strain (AN0803), and follow the reverse transcriptase SuperScript TM III Reverse Transcriptase Instructions Synthesize the first-strand cDNA, then use the cDNA as a template to design primers for PCR amplification.

[0065] The primers used for amplification are as follows:

[0066] F-NGlu(EcoRI):

[0067] 5'CAGTA GAATTC ATGGACGCCGATGGTGGTC3'

[0068] R-NGlu(NotI):

[0069] 5'CAGTAC GCGGCCGC TTAGGAGCTAGATTGGCACT3'

[0070] After the PCR, the PCR product was purified and digested with EcoRI and NotI, and then connected to the vector pPICzaA that had undergone the same double digestion. The ligated product was transformed into E. coli Topl0 competent cells, and coated with the antibiotic Zeocin on a YPD plate for Screen to obtain positive clones. The plasmids of positive clones were extracted...

Embodiment 3

[0071] Example 3, Construction and Screening of Pichia pastoris Engineering Bacteria Containing Novel β-Glucanase Gene GNGlu

[0072] The obtained recombinant expression vector GNGlu-pPICzaA was linearized with SacI, and the linearized recombinant vector was electroporated to transform Pichia pastoris X33, and after electrotransformation, it was spread on a YPD (Zeo+) plate for screening to obtain a recombinant strain of Pichia pastoris , and cultured statically at 30°C for 3-4 days.

[0073] Conditions for electrotransformation of yeast competent cells: U=1500V, C=25μF, R=200Ω.

[0074] A single colony grown on the YPD (Zeo+) plate was selected for shake flask fermentation culture to induce enzyme production, and the strain with the highest production level of β-glucanase was screened out, and the number was GNGlu-pPICzaA-X33-36.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the fields of gene engineering and fermentation engineering and specifically relates to an acidic beta-glucanase NGlu as well as a gene and application thereof. The invention provides a novel beta-glucanase NGlu with an amino acid sequence as shown in SEQ ID NO.1; furthermore, the invention also provides a gene GNGlu for encoding the novel beta-glucanase, and the nucleotide sequence of the gene is as shown in SEQ ID NO. 2; the invention also provides a recombinant vector and a recombinant bacterial strain both comprising the gene and application of the recombinant vector and the recombinant bacterial strain. The novel beta-glucanase is capable of achieving a relatively high fermentation level by virtue of efficient expression, so that the production cost can be reduced to a large extent in industrial production; as a result, the novel beta-glucanase has excellent application prospect in industries such as feed and beer brewing.

Description

technical field [0001] The invention relates to the field of genetic engineering and fermentation engineering, in particular, the invention relates to a β-glucanase NGlu and its gene and application. Background technique [0002] β-glucan widely exists in plant cell walls, and is a glucan polymer formed by glycosidic bonds of mixed β-1,3 and β-1,4, which is a structural non-starch polysaccharide (Non-starch polysaccharides, NSP), especially in the aleurone layer and endosperm cell wall of cereals (such as barley, oats, rye and wheat, etc.). β-glucan is divided into two types: water-soluble and water-insoluble. The proportion of water-soluble β-glucan is relatively large, and it can form viscous substances with water, and the higher the concentration of β-glucan, the higher the viscosity. Big. [0003] β-Glucanase (β-Glucanase, E.C 3.2.1.73) is a hemicellulolytic enzyme mainly derived from microorganisms, including bacteria (Bacillus), fungi (Aspergillus, Mucor, Trichoderma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12R1/84
CPCC12N9/2448C12Y302/01073
Inventor张慧君王俊峰张鹏鹏林海晶
OwnerJIANGSU YINONG BIOLOGY CO LTD