Treatment method of phosphorus-containing sewage
A sewage treatment and sewage technology, applied in water/sewage treatment, water/sewage multi-stage treatment, water/sludge/sewage treatment, etc., can solve the problem of unsatisfactory treatment capacity and treatment effect, secondary pollution, high operating cost, etc. problem, to achieve good commercial value and good degradability effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1 The method of sewage treatment
[0024] An efficient sewage treatment method is characterized in that it comprises the following process steps:
[0025] The treated sewage water quality is as follows: CODcr450mg / L, BOD5150mg / L, SS≤200mg / L, NH3-N≤130mg / L, T-P≤100mg / L, pH=6.5-9.0.
[0026] (1) Pretreatment: Send the sewage into the filter tank, in which the original phosphorus content is to remove large particles and fiber impurities, and then send it into the grit chamber to remove sand particles with a specific gravity of 2-3g / cm3 and a particle size of 0.2mm or more , sent to the adjustment pool;
[0027] (2) Biochemical treatment: introduce sewage into the anoxic tank in the denitrification process, control the hydraulic retention time for 8-12 hours, control the dissolved oxygen to be less than 0.6mg / L, remove BOD, and convert the nitrogen in NO3- into nitrogen at the same time; The sewage from the anoxic pool is introduced into the anaerobic pool, and...
Embodiment 2
[0033]Example 2 Construction of Phosphorus Accumulating Bacteria Genetic Engineering Bacteria
[0034] According to the design of primers using DNAMAN software, BamHI and SalI restriction sites were added respectively. The sequence of the forward primer is: ATGTCGCAACTCAATTCCAA; the sequence of the reverse primer is: GGAGTGCAGCTGTACGGGGTC.
[0035] The target fragment was obtained by amplification, and the Qujjl-1 gene was obtained by PCR amplification. The fragment size was about 1200bp. Through sequencing, it was found that the amplification was correct.
[0036] Mutate the corresponding 24D / V, 60Q / F, 122Q / G, 153E / S, 183N / G, 199I / A, 236A / G, 253P / A, 309F / G, 367S / P, 373D / G mutations by multiplex PCR The sites are respectively introduced into the gene sequence encoding it (can be obtained by referring to the preparation method in the prior art). Thus, different mutant genes were obtained, which were loaded into the expression vector PWB980, and the successfully verified re...
Embodiment 3
[0037] Example 3 Verification of Phosphorus Removal Effect of Phosphorous Accumulating Bacteria Genetic Engineering Bacteria
[0038] According to the method of Example 1, the corresponding sewage treatment experiment was carried out, and different recombinant bacteria were used for phosphorus accumulation reaction. It was found through experiments that 24D / V, 60Q / F, 122Q / G, 153E / S, 183N / G, 199I / A, 236A / G, 253P / A, 309F / G, 367S / P, and 373D / G mutants all had significantly enhanced effects compared with the original strain, while 219N / S strain showed no enhanced effect. Phosphorus effect. The total treatment time is not more than 3 days, and the result is as follows: the sewage is the same batch of sewage, so as to ensure the same conditions.
[0039]
[0040] It can be seen that, with the method of the present application, the efficiency of 3d dephosphorization is higher than that of the prior art. Therefore, it can be used for large-scale sewage treatment. It also has a ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More