C-type lectin Nattectin gene of larimichthys crocea, C-type lectin Nattectin recombinant protein of larimichthys crocea and application of C-type lectin Nattectin recombinant protein

A technology of recombinant protein and large yellow croaker, which is applied in the field of animal lectin, can solve the problems of bacterial agglutination, difficulty in maintaining biological activity, and difficult refolding of inclusion bodies without Nattectin, and achieve protein stability, easy binding, and simple refolding Effect

Inactive Publication Date: 2015-11-18
JIMEI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there has been no report on the bacterial agglutination of Nattectin so far, and the present invention is the first case of discovering the bacterial agglutination of Nattectin
[0004] Recombinant C-type lectin proteins mostly exist in the form of inclusion bodies, which are difficult to refold and maintain biological activity. Therefore, they are largely limited in practical applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • C-type lectin Nattectin gene of larimichthys crocea, C-type lectin Nattectin recombinant protein of larimichthys crocea and application of C-type lectin Nattectin recombinant protein
  • C-type lectin Nattectin gene of larimichthys crocea, C-type lectin Nattectin recombinant protein of larimichthys crocea and application of C-type lectin Nattectin recombinant protein
  • C-type lectin Nattectin gene of larimichthys crocea, C-type lectin Nattectin recombinant protein of larimichthys crocea and application of C-type lectin Nattectin recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Acquisition of Nattectin cDNA Sequence of Large Yellow Croaker C Lectin

[0040] 1. Extraction of total RNA from the spleen of large yellow croaker and synthesis of cDNA by reverse transcription

[0041] The total RNA of large yellow croaker spleen was extracted with Trizol reagent, the integrity of RNA was detected by 1% agarose gel electrophoresis, and the concentration and purity of RNA were detected by ultraviolet spectrophotometry. The RNA was reversed with the M-MLV Reverse Transcriptase Kit to obtain the first strand of cDNA.

[0042] 2. Obtain the NattectincDNA sequence of large yellow croaker C lectin

[0043] The Nattectin gene sequence was spliced ​​according to the large yellow croaker transcriptome database in our laboratory, and a pair of specific primers were designed to amplify the large yellow croaker C lectin Nattectin. The primer sequences are:

[0044] Forward primer NF: ATGGCATCAGCTCTTCATTTCA;

[0045] Reverse primer NR: TTGTAAGGCGTCCTTGGCAC.

...

Embodiment 2

[0053] Preparation of Recombinant Protein of New C Lectin Nattectin from Large Yellow Croaker

[0054] 1. Construction of pET-32a-Nattectin expression vector

[0055] (1) PCR amplification of Nattectin gene

[0056] The total RNA of the spleen of large yellow croaker was extracted, and the cDNA of the spleen was amplified with OligdT as primer. According to the large yellow croaker transcriptome data (measured in our laboratory), the primers were designed as follows:

[0057] PF:CCG GAATTC ATGGCATCAGCTCTTCATTTCA (the underlined part is the restriction site of BamHI restriction); PR: CCG CTCGAG TTGTAAGGCGTCCTTGGCAC (the underlined part is the EcoRI restriction site).

[0058] Using the spleen cDNA of large yellow croaker as a template, the Nattectin gene of about 477 bp was amplified with primers PF / R.

[0059] (2) The PCR product and pET-32a were simultaneously digested with BamHI and EcoRI and recovered, and then ligated overnight at 16°C.

[0060] (3) After the ligati...

Embodiment 3

[0073] Agglutination of Recombinant Protein Nattectin on Bacteria

[0074] (1) Isolate and purify the bacteria, and adjust the cell concentration to 2.0×10 8 cell / ml.

[0075] (2) Bacterial agglutination was performed on a 96-well U-shaped plate. First add 50fμl TBS to each well after the first well, then add 100μl (150ug / mL) protein sample to the first well, mix well, then draw 50μl from the first well and add to the second well, and so on Doubling dilution. Finally, add various suspensions of bacteria to each well and mix thoroughly, and place at room temperature for 1 hour. Observe the agglutination status of various bacteria under a microscope and record the minimum agglutination concentration of Nattectin for different bacteria. At the same time, BSA was used as a negative control for parallel experiments.

[0076] (3) The results showed that the C lectin Nattectin recombinant protein was effective against Escherichia coli (E.Coli), Vibrio parahaemolyticus (V.parahaem...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a C-type lectin Nattectin gene of larimichthys crocea, C-type lectin Nattectin recombinant protein of the larimichthys crocea and an application of the C-type lectin Nattectin recombinant protein, and relates to animal lectins. The amino acid sequence of C-type lectin Nattectin of the larimichthys crocea is represented as SEQ ID NO: 1. The nucleotide sequence of the C-type lectin Nattectin gene of larimichthys crocea is represented as SEQ ID NO: 2. A pET-32a-Nattectin recombinant expression vector is constructed; an escherichia coli expression strain pET-32a-Nattectin-BL21 with high-copy transformants is acquired; fermented cultivation and induced expression of the transformants are performed; recombinant protein Nattectin purification and renaturation are performed. The C-type lectin Nattectin recombinant protein of the larimichthys crocea can be applied to mediated bacteria agglutination and mediated red blood cell agglutination. The bacterial agglutination function and renaturation with one-step desalination method of Nattectin are discovered for the first time, a large amount of soluble bioactive protein is obtained finally, and the operation process is very simple.

Description

technical field [0001] The invention relates to animal lectins, in particular to a large yellow croaker C lectin Nattectin gene and its recombinant protein and application. Background technique [0002] Large yellow croaker is one of the seawater economic fish with the largest breeding volume in my country, with an annual direct output value of several billion yuan. However, in recent years, due to the increase of breeding density and the aggravation of seawater pollution, epidemic diseases have occurred frequently, which has seriously hindered the healthy development of large yellow croaker farming and caused huge economic losses. At present, chemical drugs, such as antibiotics, are mainly used for the prevention and treatment of large yellow croaker diseases. However, this has caused a series of problems such as enhanced drug resistance of pathogenic bacteria, excessive drug residues in aquatic products, and serious environmental pollution. Therefore, it has become the f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/46C12N15/12C12N15/70C07K1/16
CPCC07K14/461
Inventor张东玲吕常欢王志勇
OwnerJIMEI UNIV