Genetic engineering strain for producing phenazine-1-carboxylic acid and application of genetic engineering strain

A technology of genetically engineering strains and genes, applied in the field of bioengineering, can solve the problems of complex metabolites, difficulty in strain transformation, pathogenicity of strains, etc., and achieve the effects of high fermentation level, easy separation and extraction, and fewer species.

Inactive Publication Date: 2015-11-25
SHANGHAI JIAO TONG UNIV
View PDF8 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to overcome the problems of bacterial strain pathogenicity, complex metabolites and difficulty in bacterial strain transformation in the process of producing phenazine-1-carboxylic acid by using Pseudomonas aeruginosa in the above-mentioned technology, and to provide a method for using Pseudomonas aeruginosa Method for bacterial production of phenazine-1-carboxylic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain for producing phenazine-1-carboxylic acid and application of genetic engineering strain
  • Genetic engineering strain for producing phenazine-1-carboxylic acid and application of genetic engineering strain
  • Genetic engineering strain for producing phenazine-1-carboxylic acid and application of genetic engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Construction of in vitro mutant of phzH gene-insertion mutation

[0046] Using the pBS(kan) plasmid as a template, the kanna resistance gene kan was amplified by PCR. Primers were designed according to the phzH gene sequence in the Pseudomonas chloropinus HT66 genome,

[0047] 5'-TT AAGCTT ACCCAGCCGATGGTCTATCGCTTTG-3' (HindIII, such as SEQ ID NO.3) and

[0048] 5'-AA GAGCTC CGCGATAGCCGTGAGGGTGGTGGAGT (SacI, such as SEQ ID NO. 4). Using the HT66 gene as a template, the phzH gene was amplified by PCR, digested with HindIII and SacI, and cloned into the same site of the pEX18Tc plasmid to obtain the recombinant plasmid pEX18Tc-phzH. Transformed into E.coliDH5α competent cells to make them resistant to tetracycline.

[0049] Recombinant plasmid pEX18Tc-phzH and Kanna resistance gene kan were respectively digested with SphI, recovered and ligated with T4 ligase. The ligation product was directly transformed into E.coliDH5α competent cells by heat shock at...

Embodiment 2

[0051] Embodiment 2, Construction of in vitro mutants of phzH gene-scarless knockout

[0052] Design primers according to the phzH and upstream and downstream sequences in the genome of Pseudomonas chloropinus HT66, upstream

[0053] CG GGATCC CGACGGGGGACCATCGTTCTAT-3' (BamHI, such as SEQ ID NO.5) and

[0054] 5'-ATTCATTGAGGCACGCCAAG-3' (such as SEQ ID NO.6), downstream

[0055] 5'-CTTGGCGTGCCTCAATGAATTTGGATCTCCTGCCGCTTTT-3' (such as SEQ ID NO.7) and 5'-CCC AAGCTT GACCTTGCAGGTCGGTGCGATA-3' (HindIII, such as SEQ ID NO.8), uses the genomic DNA as a template to amplify the corresponding fragment in the genome. The upstream and downstream PCR products were ligated by fusion PCR, and the fusion PCR product and the pK18mobsacB vector were digested with BamHI and HindIII respectively, recovered through the column, and ligated with T4 ligase to obtain in vitro mutant plasmids and transform Escherichia coli S17.

[0056] The S17 strain carrying the recombinant plasmid was fully...

Embodiment 3

[0058] Embodiment 3, Biosynthesis of Phenazine-1-Carboxylic Acid in Genetically Engineered Bacteria P3ΔphzH

[0059] Taking Pseudomonas chlorospinosa HT66 as the object, after mutagenesis by ultraviolet light and nitrosoguanidine, a high-yielding PCN strain of Pseudomonas chlorospinatus P3 was screened. Inoculate the activated P3 strain and its engineered strain P3ΔphzH in KMB medium (peptone 20.0g, glycerol 15.0ml, K 2 HPO 4 0.514g and MgSO 4 0.732g per liter), placed on a constant temperature shaker (180 rpm) at 28°C to cultivate until the optical density (OD600) is between 0.5 and 2.0, the above bacterial solution is in a volume ratio of 1 to 10:100, Add it into the newly prepared KMB medium, carry out shaking culture at 24-30°C, shaker speed 100-300 rpm, culture time 24-72h, and then harvest the bacterial liquid. Take 0.5 mL of fermentation broth, add 3 mL of ethyl acetate, shake and mix well, centrifuge at 6000 rpm for 5 min, take 0.2 mL of organic phase, evaporate a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic engineering strain for producing phenazine-1-carboxylic acid, which is produced by taking pseudomonas chlororaphis as a culture, as well as application of the genetic engineering strain; the genetic engineering strain is obtained by knocking out a phzH gene in pseudomonas chlororaphis genome. The genetic engineering strain for producing phenazine-1-carboxylic acid is finally prepared by deleting the phzH gene in the genome of the strain by virtue of insertion mutation or marker-less deletion from pseudomonas chlororaphis HT66 CCTCC NO: M2013467 which can naturally secrete phenazine-1-formamide as well as derivatives of the pseudomonas chlororaphis so as to convert a secondary metabolite from the phenazine-1-formamide into the phenazine-1-carboxylic acid. The invention also discloses a preparation method and a detection method of the fungicide.

Description

technical field [0001] The invention belongs to the field of bioengineering, and in particular relates to a genetically engineered bacterial strain for producing phenazine-1-carboxylic acid and its application. Background technique [0002] As a country with a large population and food, in recent decades, in order to solve the food problem, a large number of chemical pesticides have been used to prevent and control pests and diseases, but it has also caused great pollution to the environment and endangered human health. According to statistics, the average amount of pesticide use in my country's farmland is 2 to 5 times the world average (Zhang Jiansen. The average amount of pesticide use in my country is 2.5 to 5 times higher than the world. Pesticide Market Information, 2011 (7): 7). Extensive use of chemical pesticides has resulted in severe resistance of many diseases and insect pests, and the control effect has been continuously reduced. Compared with chemical pesticid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/63A01N43/60A61P3/00C12P17/12C12R1/38
Inventor彭华松谭剑张雪洪
OwnerSHANGHAI JIAO TONG UNIV