OsXDH (oryza sativa xanthine dehydrogenase) gene and genetic engineering application of OsXDH gene in delaying leaf senescence

A xanthine dehydrogenase, rice technology, applied in the field of genetic engineering, can solve the problems of senescence, accelerated leaf, cell and tissue damage, etc., and achieve the effect of delaying senescence and delaying leaf senescence

Inactive Publication Date: 2015-12-02
JIANGXI AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Under normal circumstances, plants can scavenge free radicals in the body by their own reactive oxygen species (Reactive Oxygen Species, ROS) elimination system (enzyme system and reducing substances), but when the plant enters the agin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Collection of the identified model plant Arabidopsis thaliana from DNA public databases XD GenBank (http: / / www.ncbi.nim.nih.gov.blast / ) database was searched for the gene sequence, and it was found that there is only one transcript with high similarity on chromosome 3 in rice, numbered OSJNBa0091B22.11, in the whole Primers were designed at both ends of the long coding sequence, and the first strand of cDNA prepared by reverse transcription of rice total RNA was used as a general sequence template for PCR amplification and sequencing.

[0016] Primer Sequence(5'→3') Restriction site CDS-F TCGAGTTGATCGATCGCCCGG A

CDS-R ACACGCCATTGGGCTGAGCCCT

OE-F TCCGTCGACCTGCA GGTACC CGACAAGCATAAACCTTTAATGACCCT Kpn I OE-R TCCGTCGACCTGCA GGTACC ACACGCCATTGGGCTGAGCCCT Kpn I 1390-F TGCCTTCATACGCTATTT ATTTGC

FAD2-R GAAGCGACGGACCTGGAGAT

FAD2-F CCTTTCACAACCTGATTTCCCA

1390-R TAATCATCGCAAGACCGGCAACAG...

Embodiment 2

[0020] By searching the rice genome database, the results showed that QUR It is a single-copy gene, consisting of 14 exons and 13 introns. The full-length cDNA is 4485bp, and the coding region is 4110bp, including a 4110bp open reading frame, 130bp non-coding region at the 5' end, and 130bp at the 3' end The non-coding region is 245bp, encoding a 150KDa protein of 1368 amino acids, with a leader sequence of 43 amino acids at the N-terminal. According to the analysis results of DNAStar, the isoelectric point of rice XDH is 6.81, which shows no strong hydrophilicity / hydrophobicity. The protein XDH was predicted by the online prediction software of protein subcellular location, and the results showed that XDH was a mitochondrial protein. The amino acid sequence transmembrane structure of XDH was predicted and analyzed by the TMHMM2.0 online tool, and the amino acid sequence transmembrane prediction results showed that , the protein does not form a transmembrane domain.

[0021]...

Embodiment 3

[0024] Observation of Rice Seedling Roots, Stems, Leaves and Leaves at Different Growth Stages by Semi-quantitative RT-PCR QUR Changes in mRNA transcript abundance to detect QUR Gene expression patterns. Using PCR amplification to adjust the internal reference consistency, this experiment Actin2 and QUR The number of reaction cycles was 28 and 26, respectively, and the expression was 28 in different periods. Amplify the target fragment, in the roots, stems and leaves of the seedling stage QUR The expression levels of the genes are basically the same, indicating that XDH is constitutively expressed; rice leaf seedling stage and tillering stage QUR The expression of the gene is basically the same, but the late QUR gene expression was significantly higher.

[0025] Application of real-timePCR to Different Lines of Rice XD The expression of upstream and downstream genes and aging-related genes were analyzed. Wild type and XDH overexpression transgenic lines UO The expr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a nucleotide sequence and protein sequence of a novel OsXDH (oryza sativa xanthine dehydrogenase) gene and a function of the OsXDH gene in delaying leaf senescence through overexpression, and belong so the field of genetic engineering. The cDNA (complementary deoxyribonucleic acid) sequence of the OsXDH is shown in the SEQ ID NO.1 and a coded amino acid sequence is shown in the SEQ ID NO.2. The novel OsXDH gene plays an important role in a purine metabolism process and catalyzes xanthine and hypoxanthine to generate uric acid. MRNA (messenger ribonucleic acid) expression analysis shows that the gene shows constitutive expression, and overexpression of the gene can delay oryza sativa senescence. Transgenic experiments prove that the gene has the function of delaying oryza sativa senescence, and on the basis of the function of the OsXDH gene in delaying of oryza sativa senescence through overexpression, the gene can be used for genetic breeding of oryza sativa.

Description

technical field [0001] A new rice xanthine dehydrogenase gene of the present invention QUR The overexpression thereof can delay rice senescence, belongs to the field of genetic engineering, and specifically relates to genes for degrading rice xanthine and hypoxanthine and delaying rice senescence. technical background [0002] Leaf senescence is an inevitable life phenomenon in the process of plant development. However, in agricultural production, premature leaf senescence often reduces the overall photosynthetic level of the plant and reduces photosynthetic products, resulting in low crop yield and poor quality. Some super rice varieties bred in recent years are subjected to adversity stress in the late stage of growth, such as extreme temperature, drought, nutrient deficiency, etc., and the functional leaves often senescence, resulting in low seed setting rate and high empty seedling rate, which seriously affects the yield potential of super rice. play. According to th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/53C12N9/04
Inventor 吴自明韩瑞才江卫平汪欲鹏潘晓华石庆华
Owner JIANGXI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap