OsXDH (oryza sativa xanthine dehydrogenase) gene and genetic engineering application of OsXDH gene in delaying leaf senescence
A xanthine dehydrogenase, rice technology, applied in the field of genetic engineering, can solve the problems of senescence, accelerated leaf, cell and tissue damage, etc., and achieve the effect of delaying senescence and delaying leaf senescence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0015] Collection of the identified model plant Arabidopsis thaliana from DNA public databases XD GenBank (http: / / www.ncbi.nim.nih.gov.blast / ) database was searched for the gene sequence, and it was found that there is only one transcript with high similarity on chromosome 3 in rice, numbered OSJNBa0091B22.11, in the whole Primers were designed at both ends of the long coding sequence, and the first strand of cDNA prepared by reverse transcription of rice total RNA was used as a general sequence template for PCR amplification and sequencing.
[0016] Primer Sequence(5'→3') Restriction site CDS-F TCGAGTTGATCGATCGCCCGG A
CDS-R ACACGCCATTGGGCTGAGCCCT
OE-F TCCGTCGACCTGCA GGTACC CGACAAGCATAAACCTTTAATGACCCT Kpn I OE-R TCCGTCGACCTGCA GGTACC ACACGCCATTGGGCTGAGCCCT Kpn I 1390-F TGCCTTCATACGCTATTT ATTTGC
FAD2-R GAAGCGACGGACCTGGAGAT
FAD2-F CCTTTCACAACCTGATTTCCCA
1390-R TAATCATCGCAAGACCGGCAACAG...
Embodiment 2
[0020] By searching the rice genome database, the results showed that QUR It is a single-copy gene, consisting of 14 exons and 13 introns. The full-length cDNA is 4485bp, and the coding region is 4110bp, including a 4110bp open reading frame, 130bp non-coding region at the 5' end, and 130bp at the 3' end The non-coding region is 245bp, encoding a 150KDa protein of 1368 amino acids, with a leader sequence of 43 amino acids at the N-terminal. According to the analysis results of DNAStar, the isoelectric point of rice XDH is 6.81, which shows no strong hydrophilicity / hydrophobicity. The protein XDH was predicted by the online prediction software of protein subcellular location, and the results showed that XDH was a mitochondrial protein. The amino acid sequence transmembrane structure of XDH was predicted and analyzed by the TMHMM2.0 online tool, and the amino acid sequence transmembrane prediction results showed that , the protein does not form a transmembrane domain.
[0021]...
Embodiment 3
[0024] Observation of Rice Seedling Roots, Stems, Leaves and Leaves at Different Growth Stages by Semi-quantitative RT-PCR QUR Changes in mRNA transcript abundance to detect QUR Gene expression patterns. Using PCR amplification to adjust the internal reference consistency, this experiment Actin2 and QUR The number of reaction cycles was 28 and 26, respectively, and the expression was 28 in different periods. Amplify the target fragment, in the roots, stems and leaves of the seedling stage QUR The expression levels of the genes are basically the same, indicating that XDH is constitutively expressed; rice leaf seedling stage and tillering stage QUR The expression of the gene is basically the same, but the late QUR gene expression was significantly higher.
[0025] Application of real-timePCR to Different Lines of Rice XD The expression of upstream and downstream genes and aging-related genes were analyzed. Wild type and XDH overexpression transgenic lines UO The expr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com