Puccinia striiformis quantitative detection kit and application thereof

A technology for quantitative detection of wheat stripe rust, applied in the direction of microbial measurement/inspection, microbial-based methods, microorganisms, etc., can solve the problems that have not yet been reported on the early quantitative monitoring method of wheat stripe rust, and achieve reliable detection means, High amplification efficiency and low detection limit

Active Publication Date: 2015-12-30
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, some qualitative detection researches on the pathogenic bacteria of wheat stripe rust have been carried out at home and abroad, but there is no report on the early quantitative monitoring method of wheat stripe rust

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Puccinia striiformis quantitative detection kit and application thereof
  • Puccinia striiformis quantitative detection kit and application thereof
  • Puccinia striiformis quantitative detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1, employing fungal conserved gene primers to analyze wheat rust

[0054] With reference to the nucleotide sequence of Bt2a / Bt2b reported in "GlassandDonaldson, 1995.":

[0055] Bt2a: 5'-GGTAACCAAATCGGTGCTGCTTTC-3' (Seq ID No. 1),

[0056] Bt2b: ​​5'-ACCCTCAGTGTAGTGACCCTTGGC-3' (Seq ID No. 2).

[0057] The PCR analysis of gDNA of wheat stripe rust, leaf rust fungus and stem rust fungus was carried out on the PTC2220 PCR instrument of MJResearch, Inc.

[0058] The amplification system is 25 μL, including 10×PCRBuffer (Mg2+Plus) 2 μL, dNTPMixture (2.5 mmol / L each) 0.3 μL, Bt2a / Bt2b (10 μmol / L) 1 μL, template DNA (20ng / μL) 1.0 μL, TaKaRaTaq (5U / μL) 0.3 μL, ddH2O 16.9 μL.

[0059] The PCR reaction conditions were: 94°C for 2 min, 1 cycle; 94°C for 15 s, 55°C for 30 s, 72°C for 90 s, 30 cycles; 72°C for 10 min, 1 cycle.

[0060] The amplified products were separated by agarose gel with a mass fraction of 1.5 and 0.5×TBE electrophoresis buffer, and the electrop...

Embodiment 2

[0062] Embodiment 2, the preparation of kit of the present invention

[0063] 1. Acquisition of primers

[0064] According to the stripe rust specific sequence SeqID No.3 obtained in Example 1, a series of primers for fluorescent quantitative PCR detection were designed using the software Primer5.0.

[0065] After primer screening and verification, the specific primers in the kit of the present invention are finally obtained, and the nucleotide sequences of the forward and reverse primers are as follows:

[0066] osgQ607 / osgQ608:

[0067] GGATGCCTCGAAGGGTTATACC (Seq ID No. 5) / TGCTAGATACAATGGCACATCTGA (Seq ID No. 6).

[0068] 2. Kit Assembly

[0069] The primers, 2×SGPCRMasterMix, 2×SGGreenqPCRMix (withROX) and double-distilled water are combined according to a certain dosage ratio to assemble the kit described in the present invention.

Embodiment 3

[0070] Embodiment 3, kit of the present invention detects wheat sample

[0071] step:

[0072] A. Obtain standard curve

[0073] 1. Preparation of DNA standard: Extract the genomic DNA (plasmid DNA) of the stripe rust CY33 strain according to the operating instructions of the plasmid DNA extraction kit, and use the plasmid DNA as a template to add primers osgQ607 / osgQ608 and common PCR amplification reagents (as in Table 1) PCR amplification; the reaction system of the PCR amplification is as shown in Table 1; the reaction program is as shown in Table 2; the amplified stripe rust PCR product is the DNA standard.

[0074] Table 1

[0075]

[0076]

[0077] Table 2

[0078]

[0079] 2. Use a spectrophotometer to measure the concentration of the above PCR product to be 498ng / μl, carry out gradient dilution according to a tenth ratio to form a series of DNA standard dilutions, and calculate the copies of the serial dilutions according to the gradient concentration an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a puccinia striiformis quantitative detection kit and application thereof. The kit comprises a normal reagent for fluorescent quantitation PCR amplification, and is characterized by further comprises a primer for detecting puccinia striiformis; the forward and reverse nucleotide sequences of the primer are as follows: osgQ607 / osg / Q608:GGATGCCTCGAAGGGTTATACC / TGCTAGATACAATGGCACATCTGA. The invention further discloses a method for quantitatively detecting the number of puccinia striiformis copies in wheat by utilizing the kit. Through adoption of the kit and the method, the infection amount of puccinia striiformis in a gleying state can be measured relatively accurately and quantitatively, the characteristics such as a low detection limit as well as high sensitivity, specificity and amplification efficiency are achieved, and a reliable detection means is provided for early prediction and control of wheat stripe rust.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a quantitative detection kit for wheat stripe rust and its application. Background technique [0002] Early monitoring and quantitative analysis of wheat stripe rust has always been one of the important links in the control of the disease. Especially when the wheat seedling rust is in the incubation stage, it is of great significance to establish a rapid and accurate determination method for the prediction and control of the disease. The degree of occurrence of the disease can be determined and predicted as early as possible during the incubation period of the disease, and before the disease spreads in a large area, rapid and accurate early monitoring can be used to formulate chemical control measures in time to reduce the initial bacterial source and inhibit or slow down the disease. develop. [0003] For a long time, the existing monitoring methods, such as manual investigation, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/645
CPCC12Q1/6851C12Q1/6895C12Q2531/113C12Q2545/113C12Q2563/107
Inventor高利蔚慧欣陈万权刘太国刘博
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI