A mutant gene of the gshf gene of Streptococcus agalactiae and its application

A technique for mutating genes and Streptococcus lactis, which is applied in the field of bioengineering to achieve the effects of reducing Km value, improving catalytic efficiency and enhancing affinity

Active Publication Date: 2018-10-02
SHANDONG JINCHENG BIO PHARMA CO LTD +1
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The high-yield glutathione engineering bacteria reported in the above literature and patents all increase the amount of GSH synthesis by overexpressing glutathione synthesis-related enzymes. Among them, GSH A or GSH Ⅰ is due to the feedback inhibition of GSH, and its K i About 3mM, so that the GSH production will not be very high, although the bifunctional glutathione synthetase can synthesize GSH in one step, the inhibition constant K of GSH to GshF derived from Listeria monocytogenes i 5mM, still inhibited by GSH feedback

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A mutant gene of the gshf gene of Streptococcus agalactiae and its application
  • A mutant gene of the gshf gene of Streptococcus agalactiae and its application
  • A mutant gene of the gshf gene of Streptococcus agalactiae and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] In this example, an error-prone PCR method was used to construct a mutant library of the glutathione bifunctional enzyme gene, and to screen glutathione bifunctional enzyme mutants with high enzymatic activity.

[0028] 1. Construction of recombinant plasmid pUC19-gshF.

[0029] Template: Streptococcus agalactiae S. agalactiaeATCC-BAA611 genomic DNA;

[0030] Vector: PUC19 was digested with HindⅢ / PstⅠ, purified and recovered to obtain the linearized plasmid PUC19. The PUC19 is purchased from Takara Company with a catalog number of 3219.

[0031] Primers:

[0032] gshF upstream primer gshF-1:CCC AAGCTT ATGATTATCGATCAACTGTTAC;

[0033] gshF downstream primer gshF-2: TGCA CTGCAG TTATAATTCTGGGAACAGTTTA;

[0034] PCR amplification conditions: 94°C for 5min, 94°C for 30s, 65°C for 30s, 72°C for 2.5min, a total of 30 cycles.

[0035] The amplified PCR product was digested with HindⅢ / PstⅠ, and then ligated with the above-mentioned linearized plasmid PUC19 after gel cutt...

Embodiment 2

[0067] In this example, the glutathione synthase gene mutant obtained in Example 1 was used to prepare Pichia pastoris engineering bacteria.

[0068] 1. The mutant genes gshFM1, gshFM2, gshFM3 and gshF were obtained by PCR reaction.

[0069] Template: the recombinant plasmids PUC19-gshFM1, PUC19-gshFM2, PUC19-gshFM3 obtained above and the genome of Streptococcus agalactiae ATCC-BAA611

[0070] Primers:

[0071] Upstream: 5'-CAATTGAACAACTATTTCGAAACGATGATTATCGATCAACTGTTACAAAGAAG-3';

[0072] Downstream: 5'-GACGGCCGGCTGGGCCACGTGAATTTATAATTCTGGGAACAGTTTAGCCAA-3';

[0073] PCR amplification reaction: 1 μL of template, 2 μL of 10×PCR buffer, 2 μL of upstream and downstream primers, 5 μL of dNTP, 0.5 μL of TaqDNA polymerase, the total reaction volume is 20 μL, PCR cycle program: 94°C for 5min, 94°C for 30s, 65°C for 30s , 72°C for 2.5min, a total of 30 cycles. The PCR products were recovered by agarose gel electrophoresis and then digested with Cla Ⅰ and Not Ⅰ to obtain glutathio...

Embodiment 3

[0079] In this example, the Pichia pastoris engineered bacteria obtained in Example 2 were used to synthesize glutathione.

[0080] Inoculate single colonies of GS115 / gshFM1, GS115 / gshFM2, GS115 / gshFM3, GS115 / gshF and GS115 grown on YPD medium solid plates for three days at 30°C into 30mL of YPD medium, at 30°C, 220rpm Cultivate for 20 hours; then put it into 320mL of YPD medium, put it into 6L (10L fermenter) fermentation medium BMGY after 8h, add defoamer, control the temperature at 30°C, add glycerol during the process, and control the pH at the same time In 6.0. Start to add cysteine ​​after 30 hours of fermentation, keep the concentration of cysteine ​​in the fermentation broth at 0.1-0.2mmol / L, and continue to ferment until 70 hours to stop fermentation. The YPD medium components are Glucose 20g / L, Tryptone 20g / L, Yeast Extract 10g / L. The composition of the BMGY medium is: yeast 10g / L, peptone 20g / L, yeast nitrogen source 1.34g / L, 0.1M pH6.0 phosphate buffer 10mL / L, gl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutant gene of gshF genes of streptococcus agalactiae and application of the mutant gene in building high-yield glutathione engineering bacteria. The mutant gene is gshFM1 or gshFM2 or gshFM3. According to the mutant gene, a glutathione synthetase mutant, pichia pastoris engineering bacteria and saccharomyces cerevisiae gene engineering bacteria are obtained for synthesis of glutathione. The obtained dual-function glutathione synthetase mutant is not affected by feedback inhibition of glutathione and has the characteristic of being high in catalytic efficiency. The glutathione yield of genetically engineering bacteria built through the obtained mutant is high, and a foundation is laid for industrial production and preparation of glutathione.

Description

technical field [0001] The invention belongs to the field of bioengineering, and relates to a mutated gene derived from the glutathione synthase gene gshF gene of Streptococcus agalactiae ATCC-BAA611 obtained by means of directed evolution, and in the construction of Pichia pastoris and Saccharomyces cerevisiae Application of a stathione-producing strain. Background technique [0002] Glutathione (L-Glutathione) is a biologically active tripeptide formed by the condensation of glutamic acid, cysteine ​​and glycine, and its full name is 5-L-glutamyl-L-cysteinylglycine. [0003] In cells, glutathione mainly exists in two forms: reduced glutathione (GSH) and oxidized glutathione (GSSG), among which the reduced form is the main form. Glutathione has a free sulfhydryl group and a strong ability to donate electrons or proton hydrogen, so glutathione has important physiological functions: (1) As the most abundant antioxidant in cells, it protects DNA, proteins and other biological...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/70C12N1/19C12P21/02C12R1/84C12R1/865
Inventor徐志南杨修亮杭宝建陈斌斌李江涛黄磊
OwnerSHANDONG JINCHENG BIO PHARMA CO LTD