A method for preparing 3-succinylpyridine through biotransformation

A succinylpyridine and biotransformation technology, applied in the field of preparation of 3-succinylpyridine, can solve the problems of insufficient research and reports on 3-succinylpyridine, achieve low cost, realize conversion, and simple catalytic reaction system

Active Publication Date: 2018-08-17
SHANGHAI JIAOTONG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research reports on the production of 3-succinylpyridine are not enough, how to effectively obtain 3-succinylpyridine has become a problem that people hope to solve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preparing 3-succinylpyridine through biotransformation
  • A method for preparing 3-succinylpyridine through biotransformation
  • A method for preparing 3-succinylpyridine through biotransformation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1: the construction of Pseudomonas putida (Pseudomonas putida) genetically engineered bacteria, see image 3

[0048] Based on the principles of genetic engineering, in combination with relevant molecular biology methods, the construction of Pseudomonas putida genetically engineered bacteria is completed, and the specific implementation steps are as follows:

[0049] (1) Primer design: the upstream primer is spm-F:CCAC GTC GAC CAAGTTAACTGGTTATGCGAC, the enzyme cutting site is Sal Ⅰ; the downstream primer is spm-R:CCAC GAATTC AGTCCTTGGCCGAAACTTTGC, the enzyme cutting site is EcoR Ⅰ.

[0050] (2) DNA fragment amplification: Using the genome of Pseudomonas putida CCTCC M 205038 as a template, using the upstream and downstream primers described in (1), amplify by PCR technique to obtain multiple copies of the target DNA fragment.

[0051] (3) Plasmid construction and transformation: The PCR product in (2) and the shuttle plasmid pK18mob were digested with res...

Embodiment 2

[0053] Embodiment 2: Extract nicotine from waste tobacco leaves

[0054] Under laboratory conditions, the method of secondary extraction is used to extract nicotine from waste tobacco leaves. The specific implementation steps are as follows:

[0055] (1) The waste and inferior tobacco leaves are provided by Henan China Tobacco Company. The waste and inferior tobacco leaves are first dried and crushed into powder. Weigh 50g of tobacco leaf powder and add it to 600mL of distilled water. After stirring evenly, adjust the pH to 11, then continuously stirred on the stirrer for 2 hours, and stood overnight.

[0056] (2) Remove the filter residue by filtration to obtain about 500 mL of filtrate containing nicotine, add 100 mL of chloroform to it for extraction, the extraction temperature is 37 ° C, adjust the pH to 11, stir and extract for 3 hours; use a separatory funnel to remove the water phase to obtain nicotine-containing chloroform phase.

[0057] (3) Utilize 20mL dilute sulf...

Embodiment 3

[0059] Example 3: Nicotine is biotransformed to 3-succinylpyridine

[0060] (1) Biocatalyst: the microbial strain used for biotransformation is Pseudomonas putida (Pseudomonasputida) genetically engineered bacteria;

[0061] (2) Slant culture: inoculate the bacterial strain in step (1) to solid slant LB culture medium, cultivate 15 hours at 30 ℃; Described solid slant LB medium group contains 1.5% agarose, 1g / L nicotine and 50mg / L L Kanamycin;

[0062] (3) Seed culture: the thalline with good growth on the slant in step (2) is transferred to the LB liquid medium in a sterile environment, and the LB liquid medium contains kanamycin 50mg / L and 1g / L nicotine, cultivated at 30°C for 12 hours to obtain seed liquid;

[0063] (4) Scale-up cultivation: transfer the seed solution in step (3) to 1L LB liquid medium according to 2% inoculum size, which contains 50mg / L kanamycin and 1g / L nicotine , cultured at 200 rpm at 30°C for 12 hours to mid-logarithmic growth;

[0064] (5) Colle...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing 3-succinyl pyridine by means of biotransformation. The method comprises the following steps that 1, liquid containing nicotine serves as a substrate of a biotransformation reaction; 2, spmA genes of Pseudomonas putida are knocked out, and genetically engineered bacteria are obtained; 3, the genetically engineered bacteria are cultured, and then bacterial whole cells are collected to serve as a biological catalyst; 4, the transformation reaction is conducted on the bacterial whole cells and the substrate, and a product is obtained; 5, centrifugation, vacuum concentration and drying are sequentially conducted on the product, and the 3-succinyl pyridine is obtained, wherein the nicotine extracted from abandoned tobacco leaves serves as the substrate. The method provides feasibility for large-scale production of the 3-succinyl pyridine by means of a microbial transformation method. The method for preparing the 3-succinyl pyridine by means of biotransformation has the advantages that operation is easy, control is easy, transformation conditions are mild, the product is single, separation and purification are easy, the raw material cost is low, and green recycling of the abandoned tobacco leaves is achieved.

Description

technical field [0001] The invention relates to a method for preparing 3-succinylpyridine, in particular to a method for preparing 3-succinylpyridine through biotransformation. Background technique [0002] Nicotine, also known as nicotine, is the most important alkaloid in tobacco and one of the harmful components in cigarettes. It is the main factor of smoking addiction and dependence. A large amount of "harmful hazardous waste" containing nicotine is produced in the cigarette industry, and the nicotine can enter the environment through groundwater or air, which will cause great harm to the environment and human health. [0003] my country is a big cigarette producing country, and about 20% to 30% of waste tobacco leaves will be produced in the tobacco processing process. In addition, a large amount of tobacco dust accumulated in various tobacco factories, as well as a large number of discarded upper tobacco leaves and fireworks, etc., these tobacco industry The utilizatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P17/12C12N15/78C12N1/21C12R1/40
Inventor唐鸿志王伟伟陶飞许平
OwnerSHANGHAI JIAOTONG UNIV