Method for co-production of 1,3-propanediol and glutamic acid through recombined corynebacterium glutamicum

A technology of Corynebacterium glutamicum and propylene glycol, applied in microorganism-based methods, biochemical equipment and methods, bacteria and other directions, can solve the problems of low glucose quality yield, complicated post-extraction process, low yield and the like, and achieve separation Process simplification, resolution of biosafety, effect of less by-products

Active Publication Date: 2016-03-16
GUANGDONG TSINGDA SMART BIOTECH CO LTD
View PDF8 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The main disadvantages of the process route are: 1. Klebsiella pneumoniae is an opportunistic pathogen, and its biological safety needs to be strictly controlled in the production process; 2. A large number of by-products such as acetic acid, lactic acid, succinic acid, 2,3- The synthesis of butanediol makes the whole post-extraction process very complicated; the yield of 3, 1,3-propanediol is low, usually the mass yield of 1,3-propanediol to glycerin is lower than 40%
The disadvantage of this process route is that the recombinant escherichia coli needs a lot of genetic engineering, and the mass yield of 1,3-propanediol to glucose is low, usually between 25%-40%, and the fermentation of escherichia coli needs to use expensive raw yeast powder

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for co-production of 1,3-propanediol and glutamic acid through recombined corynebacterium glutamicum
  • Method for co-production of 1,3-propanediol and glutamic acid through recombined corynebacterium glutamicum
  • Method for co-production of 1,3-propanediol and glutamic acid through recombined corynebacterium glutamicum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The recombinant plasmid pEC-dhaT-pdu overexpressing 1,2-propanediol dehydratase and its activator and 1,3-propanediol dehydrogenase gene was constructed.

[0031] The genome of Klebsiella pneumoniae HR526 was used as a template, and the primers pdu-F (tgcctgcaggtcgactctagTTAAGCATGGCGATCCCGAAATGG) and pdu-R (CGCCCGCtaaAAGGAGATATACCATGAGATCGAAAAGATTTGAAG) were used as primers for PCR to obtain the pduCDEGH operon including 1,2-propanediol dehydratase and its activator Fragment (pduCDEGH sequence shown in SEQ ID NO.2) and PCR product purification (Tiangen biological PCR product purification kit). Using the genome of Klebsiella pneumoniae HR526 as a template, primers dhaT-F (ATATCTCTTttaGCGGGCGGCTTCGTATA) and dhaT-R (ctatgacatgattacgaattAAGGAGATATACCatgAACAACTTTAATCTGCAC) were used as primers to carry out PCR to obtain 1,3-propanediol dehydrogenase gene dhaT fragment (sequence as SEQ ID NO. 1) and purified (Tiangen Biological PCR Product Purification Kit). The Escherichia ...

Embodiment 2

[0033] Knockout of the lactate dehydrogenase gene ldhA.

[0034]Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR was carried out with primers ldhA-up-F (ctatgacatgattacgaattAAAACAGCCAGGTTAGCAGCC) and ldhA-up-R (CGCCAAAGATTTTCGATCCCACTTCCTGATTTCCC) to obtain a homologous fragment ldhA-up about 500 bp upstream of ldhA and carry out PCR product purification. Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR was performed with primers ldhA-down-F (GGGATCGAAAATCTTTGGCGCCTAGTTGGC) and ldhA-up-R (ccgggtaccgagctcgaattGAGAATTTCGGCGTGCTCG) as primers, and a homologous fragment ldhA-down about 500 bp downstream of ldhA was obtained and carried out PCR product purification. Corynebacterium glutamicum suicide plasmid pK18mobsacB (JournalofBiotechnology 104 (2003) 287-299) was single-digested with EcoRI, and the ldhA-up and ldhA-down fragments were connected to pK18mobsacB in one step using GibsonAssembly kit (NEB) to obtain The recombi...

Embodiment 3

[0036] Construction of recombinant Corynebacterium glutamicum expressing 1,2-propanediol dehydratase and its activator and 1,3-propanediol dehydrogenase gene.

[0037] Using an electroporation instrument (Bio-Rad), pEC-dhaT-pdu was transformed into the wild strain of Corynebacterium glutamicum ATCC13032 and the recombinant strain C. glutamicumΔldhA knocked out of lactate dehydrogenase ldhA by electroporation. The electric shock condition was a voltage of 2.5KV, The resistance is 600Ω, and the capacitance is 25μF (the width of the shock cup is 2mm). The recombinant strains were screened on LB plate containing 25mg / L kanamycin, and named as C.glutamicum / pEC-dhaT-pdu and C.glutamicumΔldhA / pEC-dhaT-pdu respectively.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for co-production of 1,3-propanediol and glutamic acid through recombined corynebacterium glutamicum. In order to obtain the recombined corynebacterium glutamicum, the method comprises the following steps that 1, the encoding gene of 1,3-propanediol dehydrogenase is introduced into the corynebacterium glutamicum; 2, 1,2-propanediol dehydratase and the encoding gene of an activity factor of the 1,2-propanediol dehydratase are introduced into the corynebacterium glutamicum, or glycerol dehydratase and the encoding gene of an activity factor of the glycerol dehydratase are introduced into the corynebacterium glutamicum. By the adoption of the method, the corynebacterium glutamicum is used as a production strain, so that the problem of biological safety is solved, and the thallus processing cost is lowered. According to the method, in the production process that the glutamic acid and the 1,3-propanediol are fully coupled, reducing power can be fully utilized. The yield of the glutamic acid is not lowered, and meanwhile extremely-high mass conversion rate of the 1,3-propanediol to glycerinum is obtained. Moreover, the number of reaction by-products is small, and the separating process is simple and convenient.

Description

technical field [0001] The invention belongs to the field of biochemical industry, and in particular relates to a method for co-producing 1,3-propanediol and glutamic acid by using recombinant Corynebacterium glutamicum. Background technique [0002] 1,3-Propanediol is an important chemical raw material, which can be used as an organic solvent in inks, printing and dyeing, coatings, lubricants, antifreeze and other process fields. Its main use is as a monomer for the synthesis of polyester and polyurethane , especially polymerized with terephthalic acid to form polytrimethylene terephthalate (PTT). Compared with PET (polyethylene terephthalate), PBT (polybutylene terephthalate), PTT has better properties, such as better stain resistance, toughness and resilience, and UV resistance In addition, it has the advantages of wear resistance, low water absorption and low static electricity. Therefore, PTT is considered as an upgraded product of PET and has broad market prospects. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P7/18C12P13/14C12N1/21C12R1/15
Inventor陈振刘德华黄金海
OwnerGUANGDONG TSINGDA SMART BIOTECH CO LTD