Fusion protein with anti-tumor, anti-inflammation and oculopathy-treatment functions and preparation method and application thereof

A fusion protein and ophthalmic disease technology, which is applied in the direction of antineoplastic drugs, chemical instruments and methods, and medical preparations containing active ingredients, etc., can solve the problems of short half-life, single target, and high cost of chemical synthesis, and achieve low toxicity, Enhance the stability and improve the efficacy of the drug

Active Publication Date: 2016-03-23
CHINA PHARM UNIV
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Aiming at the problems of high chemical synthesis cost, short half-life and single target of existing polypeptides, the present invention provides a fusion protein with functions of anti-tumor, anti-inflammation and treatment of ophthalmic diseases and its application. The fusion polypeptide of the present invention adopts Escherichia coli The culture expression method connects two different active polypeptides instead of the chemical synthesis method and reduces the cost. The link of the intermediate Linker increases the protein molecular weight, makes prokaryotic expression possible, and prolongs the half-life of the polypeptide. At the same time, two different polypeptides Ligation is performed so that it has the respective targets of the two polypeptides, allowing the fusion protein to have dual-target functionality

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein with anti-tumor, anti-inflammation and oculopathy-treatment functions and preparation method and application thereof
  • Fusion protein with anti-tumor, anti-inflammation and oculopathy-treatment functions and preparation method and application thereof
  • Fusion protein with anti-tumor, anti-inflammation and oculopathy-treatment functions and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] (1) Construction of the carrier

[0047] The full lengths of the target genes of the two fusion proteins are 195bp and 174bp respectively, the plasmid vector is pGEX-4T-1, the cloning site is BamHI / XhoI, and the host bacteria are DH5α or CHO cells. Among them, GGATCC is a BamHI restriction site, CTCGAG is an XhoI restriction site, and TAGTAA is two stop codons.

[0048] Target gene base sequence:

[0049] The base sequence of protein A gene is:

[0050] 5' GGATCC GCATGCGATTGCCGTGGTGATTGCTTTTGCGGTGGTGGTGGTATCGTGCGCCGTGCCGACCGCGCAGCCGTGCCCGCGGAAGCCGCGGCGAAAGAAGCCGCGGCGAAAGAAGCCGCGGCGAAAGAAGCCGCGGCGAAAGCGATCGTGCGCCGTGCCGACCGCGCAGCCGTGCCCGGTGGTGGTGGTCGTGGTGAT TAGTAACTCGAG 3'

[0051] The gene base sequence of protein G is:

[0052] 5' GGATCC GCATGCGATTGCCGTGGTGATTGCTTTTGCGGTGGTGGTGGTATCGTGCGCCGTGCCGACCGCGCAGCCGTGCCCGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTATCGTGCGCCGTGCCGACCGCGCAGCCGTGCCCGGTGGTGGTGGTCGTGGTGAT TAGTAACTCGAG 3'

[0053] (2) Expression of the targ...

Embodiment 2

[0081] Inhibitory Effects of Fusion Proteins on the Proliferation of Various Tumor Cells

[0082] MTT method was used to detect the inhibitory effect of the integrin blocker fusion protein obtained in Example 1 on the proliferation of various tumor cells, including melanoma cell B16F10, gastric cancer cell MGC-803, lung cancer cell A549, liver cancer cell Hep-G2, Breast cancer cell MDA-MB-231, colon cancer cell HCT-116, human glioma U87, cervical cancer cell Hela.

[0083] Tumor cells were incubated at 37°C, 5% CO 2 When cultured in an incubator with a density of more than 90%, it was digested with trypsin and collected, and the cells were resuspended in culture medium and counted under a microscope, and the cell concentration was adjusted to 3.0×10 4 cells / mL, seed the cell suspension into a 96-well plate, 100 μL per well, and inoculate at 37°C, 5% CO 2 Incubate overnight in the incubator. Dilute fusion protein A, fusion protein G, and positive drug Taxol to respective pre...

Embodiment 3

[0124] Three-dimensional transwell method to detect the activity of fusion protein A and protein G in inhibiting the migration of human umbilical vein endothelial cells

[0125] Human umbilical vein endothelial cells (HUVEC) were incubated with endothelial cell culture medium containing 5% fetal bovine serum and 1×ECGS at 37°C, 5% CO 2 When cultured in the incubator to a confluence of more than 90%, the transwell method was used to detect the activity of fusion protein A and protein G in inhibiting the migration of endothelial cells. The endothelial cell HUVEC only used the 2nd to 8th passages. The specific operation is as follows:

[0126] (1) Dilute 10mg / mL Matrigel with DMEM medium at a rate of 1:4, spread it on the transwell chamber membrane, and air-dry at room temperature;

[0127] (2) Digest the HUVEC cells cultivated to the logarithmic growth phase with 0.2% EDTA, collect, wash twice with PBS, resuspend with endothelial cell culture medium containing 0.1% BSA, count un...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses fusion protein with anti-tumor, anti-inflammation and oculopathy-treatment functions and a preparation method and application thereof, which belong to the technical field of biological pharmacy. Specifically, the invention relates to the fusion protein of an integrin blocking agent, which has the function of inhibiting tumor angiogenesis and has the integrin affinity and the combining capacity. A rigid (R) or flexible (F) linker is adopted to fuse two polypeptides, so as to respectively obtain protein A and protein G, the medicine effect can be increased, the half-life period can be extended, the stability can be enhanced, and the fusion protein has the characteristics of strong action effect, low toxicity and the like and can be used for preventing and treating solid tumors, all kinds of inflammation and angiogenesis oculopathy. The fusion protein structurally comprises two angiogenesis inhibiting polypeptides and the amino acid linker between the two angiogenesis inhibiting polypeptides, and the fusion protein is expressed in colibacillus or eukaryocyte by using a genetic engineering method and is obtained through separation and purification of a GST (Glutathione S Transferase) affinity column.

Description

technical field [0001] The invention belongs to the technical field of biopharmaceuticals, and more specifically relates to a fusion protein with functions of anti-tumor, anti-inflammation and treatment of ophthalmic diseases, its preparation method and application. Background technique [0002] Diseases such as tumors, arthritis, inflammation caused by bacteria, and eye diseases such as AMD are all referred to as vascular-related diseases. [0003] In recent years, the morbidity and mortality of cancer in my country have been increasing. Unrestricted growth, invasion and metastasis are the hallmarks and characteristics of tumor malignancy and the main causes of treatment failure and death. Therefore, controlling tumor growth, invasion and metastasis is the main measure to improve prognosis and survival rate. In 1971, Folkman first proposed the theory that tumor growth depends on angiogenesis. Tumor angiogenesis is the morphological basis of tumor growth and metastasis. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00A61K38/17A61P35/00A61P29/00A61P27/02
CPCA61K38/00C07K14/47C07K2319/00
Inventor徐寒梅于健
OwnerCHINA PHARM UNIV