Recombinant Escherichia coli for producing 3-hydroxypropionic acid and application

A technology for recombining Escherichia coli and hydroxypropionic acid, applied in microorganism-based methods, bacteria, microorganisms, etc., can solve problems such as increasing production cost, high price, and increasing difficulty in operation, and achieves the effects of improving efficiency and increasing yield

Active Publication Date: 2016-06-08
ZHEJIANG UNIV OF TECH
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] So far, some progress has been made in the research of constructing genetically engineered bacteria to produce 3-HP, but there are still many problems: (1) Pathway modification itself requires cumbersome molecular biology operations, and additional antibiotics and inducers are often required for later cultivation, Increase the difficulty of operation and increase the production cost; (2) with Escherichia coli as the host, the 3-HP yield is relatively high, but it itself does not have glycerol dehydratase enzyme activity, the construction process is complicated, and Escherichia coli itself cannot produce the coenzyme of glycerol dehydratase Vitamin B 12 , needs to be additionally added in the fermentation system, because of its high price, which greatly increases the fermentation cost; (3) various by-products will be produced during the metabolic process, which is difficult to separate and purify; (4) the activity of glycerol dehydratase and aldehyde dehydrogenase in recombinant bacteria The balance problem also affects the increase of 3-HP production; (5) In the process of generating 3-HP, the cofactor of aldehyde dehydrogenase cannot be generated in time is also an important reason for restricting the production of 3-HP

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Escherichia coli for producing 3-hydroxypropionic acid and application
  • Recombinant Escherichia coli for producing 3-hydroxypropionic acid and application
  • Recombinant Escherichia coli for producing 3-hydroxypropionic acid and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Replacement of promoters in plasmids

[0046] Strains and plasmids: E.coliBL21(DE3) was purchased from Transgen, and expression plasmids pACYCDuet-1 and pCDFDuet-1 were purchased from Novozymes.

[0047] The replacement of promoters in plasmids pACYCDuet-1 and pCDFDuet-1 is to replace the sequence of T7 promoter on the plasmid with the sequence of tac promoter through homologous recombination.

[0048] Take the replacement of the T7 promoter of the pACYCDuet-1 plasmid with the tac promoter as an example. Cultivate the Escherichia coli strain containing the plasmid pACYCDuet-1, then use the pACYCDuet-1 plasmid as a template, use mutation primers to mutate the T7 sequence on the plasmid template into tac, and then chemically transform the reaction solution after digesting the template with DpnI endonuclease into BL21(DE3) competent cells. Then spread on the LB solid medium plate containing 50mg / L chloramphenicol, and PCR screen positive clones. Recombinant p...

Embodiment 2

[0056] 1. Cloning and expression of glycerol dehydratase and glycerol dehydratase activator in Klebsiella pneumoniae

[0057] (1) Bacterial strains and plasmids: Klebsiella pneumoniae (K. peneumoniaeDSM2026) was purchased from German DSM Company, E. coliBL21 (DE3) was purchased from Transgen Company, and the expression plasmid pACYCDuet-tac was constructed by the method in Example 1.

[0058] (2) Glycerol dehydratase gene (dhaB123) (dhaB1GeneID: 7947197; dhaB2GeneID: 7947198; dhaB3GeneID: 7947200) and glycerol dehydratase activator gene (gdrA) (gdrAGeneID: 6936977) were cloned using K. peneumoniaeDSM2026 as a template by PCR Amplified obtained. (the primer sequence of amplifying glycerol dehydratase gene and glycerol dehydratase activator gene is: DhaB1-4-F-EcoR1: CCG GAATTC ATGAAAAGATCAAAACGATTTGCAGTACT, DhaB1-4-R-HindIII:GTT AAGCTT GATCTCCCACTGACCAAAGCTGG)

[0059] The amplified product was recovered by the Clean-up kit to recover the target gene fragment.

[0060] (3)...

Embodiment 3

[0087] Embodiment 3: shake flask fermentation test of recombinant strain and recombinant strain implement the expression of SDS-PAGE target protein

[0088] The recombinant Escherichia coli constructed by the method in Example 2 was inoculated into LB medium containing 50 mg / L chloramphenicol and 50 mg / L streptomycin sulfate, and cultured at 37°C for 16 hours to obtain activated recombinant Escherichia coli.

[0089] The activated recombinant Escherichia coli was inoculated into LB liquid medium containing 50 mg / L chloramphenicol and 50 mg / L streptomycin sulfate, and cultured at 37° C. for 10 h to obtain seed liquid.

[0090] The seed solution was inoculated into a 250 mL shake flask containing 50 mL of fermentation medium containing 50 mg / L chloramphenicol and 50 mg / L streptomycin sulfate according to the inoculation amount of 6% volume concentration, and cultured with shaking at 37 ° C and 150 rpm. When OD 600 When it reaches about 0.6, add IPTG to the fermentation broth, t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant Escherichia coli for producing 3-hydroxypropionic acid and application. The recombinant Escherichia coli is constructed by introducing glycerol dehydratase gene dhaB123, glycerol dehydratase reactivation factor gene gdrA, Alpha-ketoglutarate semialdehyde dehydrogenase mutant encoding gene TUkgsadh and glycerol 3-phosphate dehydrogenase encoding gene gpd1 into host bacteria; the inhibition of glycerol to access cells is removed by using gene knock-out technology, cofactor NAD+ of aldehyde dehydrogenase is regenerated, and thus 3-HP yield is increased by 12 times.

Description

(1) Technical field [0001] The invention relates to a preparation method of 3-hydroxypropionic acid, in particular to a recombinant Escherichia coli producing 3-hydroxypropionic acid and its preparation method and application. (2) Background technology [0002] As non-renewable resources such as coal and petroleum are decreasing day by day, fuel oil biorefining technology with great potential has received more and more attention. Among them, the biodiesel industry has developed rapidly in recent years. However, for every 10 tons of biodiesel produced, 1 ton of glycerin is produced. The production of glycerin has grown rapidly, causing the price of glycerin to fall all the way down. Making full use of glycerol, which is abundant in sources and cheap in price, can bring huge economic and environmental benefits. [0003] 3-Hydroxypropionic acid (3-HP, C 3 h 6 o 3 ) and lactic acid are isomers and are an important platform compound. It is colorless and odorless, and can be ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P7/42C12R1/19
CPCC07K14/26C12N9/0006C12N9/0008C12N9/88C12P7/42C12Y101/01008C12Y102/04002C12Y402/0103
Inventor郑裕国牛坤熊涛秦海彬黄建峰柳志强
OwnerZHEJIANG UNIV OF TECH