Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Apostichopus japanicus ITGB gene, coding protein, cloning method of ITGB gene and construction method of recombinant apostichopus japanicus ITGB genetically engineered bacteria

A technology of genetically engineered bacteria and cloning method, which is applied to the construction of recombinant japonicus ITGB genetically engineered bacteria, japonicus ITGB gene, encoded protein and its cloning, which can solve problems such as the loss of japonicus aquaculture and achieve the effect of low cost

Active Publication Date: 2016-06-29
NINGBO UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the solution to diseases of sea cucumbers is mainly treatment after the onset of the disease, and it is impossible to prevent and detect the diseases before the disease. The result of this kind of practice will often cause great losses to the sea cucumber breeding industry. Therefore, the screening specificity is good. , Gram-negative bacterial binding molecules with strong binding activity are imperative. At the same time, through the construction of aquatic animal integrin gene expression engineered bacteria, industrialized and high-yield A. japonicus integrins can be produced. Adding the target protein in the environment can increase the binding ability of integrin to negative pathogenic bacteria on the basis of the integrin produced by sea cucumber itself, so as to improve the immunity of the sea cucumber body and provide a solution to the disease of sea cucumber

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Apostichopus japanicus ITGB gene, coding protein, cloning method of ITGB gene and construction method of recombinant apostichopus japanicus ITGB genetically engineered bacteria
  • Apostichopus japanicus ITGB gene, coding protein, cloning method of ITGB gene and construction method of recombinant apostichopus japanicus ITGB genetically engineered bacteria
  • Apostichopus japanicus ITGB gene, coding protein, cloning method of ITGB gene and construction method of recombinant apostichopus japanicus ITGB genetically engineered bacteria

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0049] ITGB gene cloning and sequence analysis

[0050] a. Through the EST (Expressed Sequence Tag) analysis of the cDNA library of Apostichopus japonicus japonicus japonicus in the early stage, a number of EST sequences encoding ITGB genes were found (PengjuanZhang, ChenghuaLi, LinZhu, XiurongSu, YeLi, ChunhuaJin, TaiwuLi. PlosONE2013.8(9):e73506.), a sequencing analysis of one of the EST clones showed that the clone encoded a partial fragment of A. japonicus ITGB;

[0051] b. RACE primer design: Design RACE nested primers for the partial ITGB fragment described in step a above: 3' upstream specific primer 1: GGTTCATTGTCAAATCGGAG, 3' upstream specific primer 2: GATTACGTCGCTCTGGTCCA; 5' downstream specific primer 1: CCAACAATTCTGCAACCTCCG,

[0052] 5' downstream specific primer 2: TGCAACAAGGGGCACTTGGAG, amplify 3' adapter primer Adaptor3: TACCGTCGTTCCACTAGTGATTT, amplify 5' adapter primer Adaptor5: CATGGCTACATGCTGACAGCCTA;

[0053] c. RACE amplification to obtain the full-len...

specific Embodiment 2

[0060] Full-length cloning of ITGB gene and construction and expression of recombinant protein

[0061] a. Extraction of total RNA: Take 1.0 mL of sea cucumber body cavity fluid, centrifuge at 800 g for 5 min, collect blood cells, add 1.0 mL of Trizol reagent (purchased from Takara Company), shake and mix, leave at room temperature for 5 min, then add 0.2 mL of chloroform, shake and mix , stand at room temperature for 10 minutes, centrifuge at 12,000 g at 4°C for 15 minutes, draw the supernatant into an EP tube, add an equal volume of isopropanol to the supernatant, mix well, let stand at room temperature for 5 minutes, centrifuge at 4°C, 12,000 rpm for 10 minutes, remove For the supernatant, add 1 mL of ethanol aqueous solution with a mass percentage concentration of 75% to the precipitate, centrifuge at 4°C and 12000 rpm for 5 min, remove the supernatant, let the precipitate stand for 5-10 min, add 20 μL of RNase-free water to obtain the RNA extract;

[0062] b. cDNA synthes...

specific Embodiment 3

[0068] Purification and renaturation of recombinant proteins

[0069] a. Protein purification: After collecting the bacteria by centrifugation, resuspend the bacteria with 10 mL of inclusion body washing solution per 100 mL of culture, sonicate the bacteria, centrifuge at 12000 rpm for 10 min, resuspend the precipitate with 5 mL of inclusion body solution, and ultrasonically break until the solution is basically After becoming clear, centrifuge again at 15000rpm for 20min, and absorb 1mL of Ni-NTASefinose TM Resin (Shanghai Sangong, No.: BSP033) was applied to the column, washed twice with sterile water, and then equilibrated once with inclusion body solution. The supernatant was mixed with the Ni-NTASefinose on the column before TM Resin mixed, 4 ℃ mixed for 1h. The collected effluent was applied to the column twice, and the medium was washed with miscellaneous protein washing solution, 10mL each time, and after elution for 10 times, 0.6mL denatured protein eluent was added...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an apostichopus japanicus ITGB gene, coding protein, a cloning method of the ITGB gene and a construction method of recombinant apostichopus japanicus ITGB genetically engineered bacteria. The apostichopus japanicus ITGB gene is characterized in that the apostichopus japanicus ITGB gene sequence is shown as SEQIDNO.1; the cloning method of the ITGB gene comprises the steps that nested primers of RACE are designed according to the sequence of an expression sequence tag (EST) which is homologous with the ITGB gene, and the full length of the gene is amplified through an RACE technology; the apostichopus japanicus ITGB protein sequence is shown as SEQIDNO.2, and the apostichopus japanicus ITGB protein is amplified through primers containing a BamH I locus and a Not I locus respectively; a target gene obtained through cloning is inserted into a carrier to obtain recombinant plasmid, induction expression is conducted on the recombinant plasmid, purification renaturation is conducted, and then the genetically engineered bacteria are obtained. The construction method of the recombinant apostichopus japanicus ITGB genetically engineered bacteria has the advantages that the obtained genetically engineered bacteria have high combining capacity with endotoxin lipopolysaccharide, and the combining effect with peptidoglycan and mannan is weak.

Description

technical field [0001] The invention belongs to the fields of molecular biology and genetic engineering, and in particular relates to a japonicus japonicus ITGB gene, a coded protein and a cloning method thereof, and a method for constructing a japonicus japonicus ITGB genetic engineering bacterium. Background technique [0002] β-Integrin (β-Integrin, ITGB) is a heterophilic cell adhesion molecule, which mainly mediates the interaction between cells and the interaction between cells and extracellular matrix. Almost exist in animal and plant cells. Functional studies have revealed that integrins in vertebrates play a role in maintaining the integrity of the body, and are involved in cell recognition, signal transduction and transmission, regulation of cell proliferation, differentiation, maturation, motility, migration, inflammation, wound repair, tumor metastasis, etc. important role in physiological and pathological processes. At present, the research on invertebrate int...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/10C07K14/705C12N15/70
CPCC07K14/70546C12N15/1096
Inventor 李成华王振辉张卫卫邵铱娜李晔吕志猛
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com