Supercharge Your Innovation With Domain-Expert AI Agents!

Treatment method for phosphorus-containing sewage

A technology for sewage treatment and sewage, applied in water/sewage treatment, water/sewage multi-stage treatment, water/sludge/sewage treatment, etc., can solve the problem of unsatisfactory treatment capacity and treatment effect, secondary pollution, high operating costs, etc. problem, to achieve good commercial value and good degradability effect

Inactive Publication Date: 2016-08-17
中通工程设计有限公司
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the existing various sewage treatment methods have extremely limited treatment capacity. No matter the amount of sewage treatment or the effect of sewage treatment, they are far from meeting the actual requirements of timely treatment of industrial and domestic sewage.
Because in the existing sewage treatment methods, such as biochemical method, aeration and oxygenation method, filtration method, etc., not only the investment is large, the floor area is large, the operating cost is high, but the processing capacity and treatment effect are not ideal; Condensation method, there are problems such as poor treatment effect, high operating cost, and easy to cause secondary pollution.
In addition, most of the existing sewage treatment methods have problems such as the need for supporting pipe network systems and how to reuse reclaimed water.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Treatment method for phosphorus-containing sewage

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1 The method of sewage treatment

[0024] An efficient sewage treatment method is characterized in that it comprises the following process steps:

[0025] The treated sewage water quality is as follows: CODcr450mg / L, BOD5150mg / L, SS≤200mg / L, NH3-N≤130mg / L, T-P≤100mg / L, pH=6.5-9.0.

[0026] (1) Pretreatment: send the sewage into the filter tank, in which the original phosphorus content is to remove the large particles and fiber impurities, and then send it into the grit chamber to remove the sand particles with a specific gravity of 2-3g / cm3 and a particle size of more than 0.2mm , sent to the adjustment pool;

[0027] (2) Biochemical treatment: introduce sewage into the anoxic tank in the denitrification process, control the hydraulic retention time for 8-12 hours, control the dissolved oxygen to be less than 0.6mg / L, remove BOD, and convert the nitrogen in NO3- into nitrogen at the same time; The sewage from the anoxic pool is introduced into the anaerobic...

Embodiment 2

[0033] Example 2 Construction of Phosphorus Accumulating Bacteria Genetic Engineering Bacteria

[0034]According to the design of primers using DNAMAN software, BamHI and SalI restriction sites were added respectively. The sequence of the forward primer is: ATGTCGCAACTCAATTCCAA; the sequence of the reverse primer is: GGAGTGCAGCTGTACGGGGTC.

[0035] The target fragment was obtained by amplification, and the Qujjl-1 gene was obtained by PCR amplification. The fragment size was about 1200bp. Through sequencing, it was found that the amplification was correct.

[0036] Mutate the corresponding 24D / V, 60Q / F, 122Q / G, 153E / S, 183N / G, 199I / A, 236A / G, 253P / A, 309F / G, 367S / P, 373D / G mutations by multiplex PCR The sites are respectively introduced into the gene sequence encoding it (can be obtained by referring to the preparation method in the prior art). Thus, different mutant genes were obtained, which were loaded into the expression vector PWB980, and the successfully verified recomb...

Embodiment 3

[0037] Example 3 Verification of Phosphorus Removal Effect of Phosphorous Accumulating Bacteria Genetic Engineering Bacteria

[0038] According to the method of Example 1, the corresponding sewage treatment experiment was carried out, and different recombinant bacteria were used for phosphorus accumulation reaction. It was found through experiments that 24D / V, 60Q / F, 122Q / G, 153E / S, 183N / G, 199I / A, 236A / G, 253P / A, 309F / G, 367S / P, and 373D / G all had significantly enhanced effects compared with the original strain, while 219N / S strain showed no enhanced effect. Phosphorus effect. The total treatment time is not more than 3 days, and the result is as follows: the sewage is the same batch of sewage, so as to ensure the same conditions.

[0039]

[0040] It can be seen that, with the method of the present application, the efficiency of 3d dephosphorization is higher than that of the prior art. Therefore, it can be used for large-scale sewage treatment. It also has a good eff...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides an efficient sewage treatment method. The treatment method comprises the steps of pretreatment, biochemical treatment, precipitation treatment, precipitated sewage concentration treatment and concentrated sludge dewatering treatment. According to the method, the good degradation capacity is achieved, and the phosphorus removal rate can reach 98% or above; meanwhile, the very good nitrogen and ammonia removal effect is also achieved, and the good commercial utilization value is achieved.

Description

technical field [0001] The invention relates to a sewage treatment method, which belongs to the technical field of comprehensive sewage treatment. Background technique [0002] With the development of industrial production and the improvement of people's living standards, the volume of industrial sewage and urban domestic sewage is increasing at an alarming rate. One of the reasons for threatening the human living environment. [0003] Modern wastewater treatment methods are mainly divided into three categories: physical treatment, chemical treatment and biological treatment. The physical treatment method is a wastewater treatment method that separates and recovers unresolved suspended pollutants (including oil film and oil beads) in wastewater through physical action, and can be divided into gravity separation method, centrifugal separation method and sieve retention method. The treatment units that belong to the gravity separation method include: sedimentation, flotation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C02F9/14C02F11/14C12N1/21C07K14/21C12R1/39
CPCC02F1/001C02F1/5236C02F1/56C02F3/02C02F3/28C02F9/00C02F11/14C02F2001/007C02F2301/08C07K14/21
Inventor 余素萍
Owner 中通工程设计有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com