Engineering bacteria with deletion of organic acid production pathway and its application in co-production of 1,3-propanediol, 2,3-butanediol and ethanol

A technology of organic acids and engineered bacteria, applied in the directions of bacteria, microorganism-based methods, biochemical equipment and methods, etc., can solve the problem of no co-production of chemicals, and achieve the effect of reducing yield, reducing production costs and improving production efficiency

Active Publication Date: 2019-05-24
ZHANGJIAGANG GLORY CHEM IND CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the biological production processes of 1,3-propanediol, 2,3-butanediol and ethanol have been extensively studied, but there is no report on the co-production of these three important chemicals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria with deletion of organic acid production pathway and its application in co-production of 1,3-propanediol, 2,3-butanediol and ethanol
  • Engineering bacteria with deletion of organic acid production pathway and its application in co-production of 1,3-propanediol, 2,3-butanediol and ethanol
  • Engineering bacteria with deletion of organic acid production pathway and its application in co-production of 1,3-propanediol, 2,3-butanediol and ethanol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Knockout of lactate dehydrogenase gene ldhA in Klebsiella

[0037] (1) Cloning of the homologous sequences of the upstream and downstream parts of the lactate dehydrogenase gene ldhA

[0038] Primers were designed according to the genome sequence of Klebsiella ATCC 25955, and the upstream and downstream partial homologous sequences of lactate dehydrogenase gene ldhA were PCRed. Using the genomic DNA of Klebsiella ATCC 25955 as a template, primers composed of primers ldhA-1: ATCGGAATTCAGGGTATTGAGCTGGGCGTC and primers ldhA-2: ATTCAAGCTTCGAAACCTGTCCGAACGCCA were used for PCR amplification to obtain a partial homologous sequence upstream of ldhA; primers ldhA-3 : ATTAAAGCTTCCGTTGGCGGTTTTGGCAGT and primer ldhA-4: TCTACCCGGGTTTTTCAGCCGCTTTTCTCTCT primers were used for PCR amplification to obtain partial homologous sequences downstream of ldhA. The PCR amplification conditions are: 95°C for 5 minutes; 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute, a t...

Embodiment 2

[0051] Example 2: Knockout of acetate kinase gene ackA in Klebsiella

[0052] (1) Cloning of the homologous sequences of the upstream and downstream parts of the acetate kinase gene ackA

[0053] According to the method of embodiment 1 step (1), design primer, take the genomic DNA of Klebsiella ATCC 25955 as template, carry out PCR amplification with the primer that primer ackA-1: ATCGGAATTCTAGCGGGTGGCACGAATAAT and primer ackA-2: ATTAGGATCCGCTACCGCAGTTCAGAACCA form The upstream sequence of ackA gene was obtained; the downstream sequence of ackA gene was obtained after PCR amplification with primers composed of primer ackA-3: GCAAGGATCCCTATACCATCGCACTGACCG and primer ackA-4: TCCCCCCGGGCGAGACAAAAGACTTTCATC. The PCR product is recovered and purified to obtain the target fragment.

[0054] (2) Suicide carrier build

[0055] Use restriction endonucleases EcoRI and BamHI to digest the homologous fragment upstream of the ackA gene, use BamHI and XmaI to digest the homologous frag...

Embodiment 3

[0058] Example 3: Knockout of pyruvate oxidase gene poxB in Klebsiella

[0059] (1) Cloning of the homologous sequences of the upstream and downstream parts of the pyruvate oxidase gene poxB

[0060] According to the method of embodiment 1 step (1), design primer, take the genomic DNA of Klebsiella ATCC 25955 as template, carry out PCR amplification with primer poxB-1:GCATGAATTCTTTCGCTGCCACTTTTATCCA and primer poxB-2:ATTAGGATCCGGCGAAAACCAACTGGCTCA The upstream sequence of poxB gene was obtained; the downstream sequence of poxB gene was obtained after PCR amplification with primers composed of primer poxB-3: ATGCGGATCCACGGTCTGCTTCATGATCTC and primer poxB-4: CGTACTGCAGATCTAAGCCGACCATCAGCC. The PCR product is recovered and purified to obtain the target fragment.

[0061] (2) Suicide carrier build

[0062] Use restriction endonucleases EcoRI and BamHI to digest the homologous fragment upstream of the poxB gene, use BamHI and PstI to digest the homologous fragment downstream of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineering bacterium lacking organic acid production paths and use thereof in co-production of 1,3-propanediol, 2,3-butanediol and ethanol. Lactic dehydrogenase gene of lactic acid synthesis path of Klebsiella, acetate kinase gene and pyruvic oxidase gene in acetic acid synthesis path, and fumarate reductase gene and isocitrate lyase gene of succinic acid synthesis path are inactivated, so that production of organic acids in metabolism of glycerol of the Klebsiella can be reduced, and yield and conversion rate of alcohols such as1,3-propanediol, 2,3-butanediol and ethanol can be improved, and the co-production of the 1,3-propanediol, 2,3-butanediol and ethanol can be achieved. As a significant reduction in the production of the organic acids, the extraction process of the alcohols can be simplified. The production efficiency of production of high value products by microbial conversion of glycerol can be improved, the production cost is reduced, and the engineering bacterium has important application value.

Description

technical field [0001] The invention belongs to the field of biochemical technology, and in particular relates to an engineered bacterium with a missing organic acid production pathway and its application in co-production of 1,3-propanediol, 2,3-butanediol and ethanol. Background technique [0002] 1,3-Propanediol is an important chemical raw material, which can be used in solvents, lubricants, antifreeze and other industries. At present, 1,3-propanediol is mainly used in the synthesis of polytrimethylene terephthalate (PTT), which is a kind of biodegradable polyester material with excellent performance and good ductility and washability. Plastics and other aspects have broad application prospects. Biological fermentation of sugar or glycerol to produce 1,3-propanediol is an efficient and environmentally friendly production method of 1,3-propanediol, which has attracted more and more attention. Bacteria such as Klebsiella (Klebsiella), Citrobacter (Citrobacter) and Clostri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12P7/18C12P7/06C12R1/22
CPCY02E50/10
Inventor许平王钰韩冰张怀立
OwnerZHANGJIAGANG GLORY CHEM IND CO LTD