Application of ossapk7 protein and its coding gene in improving rice bacterial blight resistance
A technology that encodes genes and leaf blight, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of loss of variety resistance and difficulty in using disease-resistant genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Example 1, OsSAPK7 gene expression analysis
[0066] 1. Sow the 9804 rice seeds in a seedling tray filled with sterilized soil, cultivate them in a greenhouse for 25 days, and then transplant them into a net room for single planting.
[0067] 2. During the tillering stage of the rice plants in step 1, the Xoo strain ZHE173 was used to artificially inoculate the rice plants by the leaf cutting method, and each plant was inoculated with 5 leaves.
[0068] 3. Complete the 0, 2, 4, 6, 9, 11, 48, 72, 96 h of manual inoculation in step 2, cut the inoculated leaves, and quickly put them in liquid nitrogen for quick freezing, and take three biological replicates for each sample. All samples were quickly frozen in liquid nitrogen and stored at -70°C.
[0069] 4. Take the sample obtained in step 3, extract the total RNA of the sample, and reverse transcribed it into cDNA.
[0070] 5. Using the cDNA obtained in step 4 as a template, perform a qRT-PCR reaction, use primer F and primer R to ...
Embodiment 2
[0078] Example 2, OsSAPK7 gene function analysis
[0079] 1. Construction of OsSAPK7 gene RNAi vector
[0080] 1. Extract total RNA from 9804 rice leaves and reverse transcribed into cDNA.
[0081] 2. Using the cDNA obtained in step 1 as a template, the primer attB-F and the primer attB-R are used for PCR amplification to obtain the amplified product.
[0082] attB-F: 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCT GGCAGCTGATGGTCACACT-3':
[0083] attB-R: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT AGATGCTCAATGAGATGGTTTT-3'.
[0084] 3. Through the BP reaction, the amplified product obtained in step 2 is introduced into the vector pDONR201 to obtain the positive entry clone plasmid pDONR201-OsSAPK7i (verified by sequencing) containing the double-stranded DNA molecule shown in sequence 3 of the sequence listing.
[0085] BP reaction system: amplified product 2.7μL (50-100ng), vector pDONR2011.0μL (30-50ng), 5×BP Reaction Buffer 1.0μL, BP Enzyme mix 0.3μL.
[0086] BP reaction conditions: 25℃ warm bath for 1h.
[...
Embodiment 3
[0115] Example 3 Application of OsSAPK7 gene in improving rice bacterial blight
[0116] 1. Construction of OsSAPK7 gene overexpression vector
[0117] 1. Extract total RNA from 9804 rice leaves and reverse transcribed into cDNA.
[0118] 2. Using the cDNA obtained in step 1 as a template, the primer attB-F1 and the primer attB-R1 are used for PCR amplification to obtain the amplified product.
[0119] attB-F1: 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTGC ATGGAGAGGTACGAGCTGCTC-3':
[0120] attB-R1: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT TCAGCTGAGCTGAAACTCACCA-3'.
[0121] 3. Through the BP reaction, the amplified product obtained in step 2 is introduced into the vector pDONR201 to obtain the positive entry cloning plasmid pDONR201-OsSAPK7 containing the double-stranded DNA molecule shown in sequence 1 of the sequence listing.
[0122] BP reaction system: amplified product 2.7μL (50-100ng), vector pDONR201 1.0μL (30-50ng), 5×BPReaction Buffer 1.0μL, BP Enzyme mix 0.3μL.
[0123] BP reaction conditions...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


