Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of ossapk7 protein and its coding gene in improving rice bacterial blight resistance

A technology that encodes genes and leaf blight, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of loss of variety resistance and difficulty in using disease-resistant genes

Active Publication Date: 2019-10-25
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the reported rice bacterial blight resistance genes, due to the difficulty of using the disease resistance genes from wild rice, the resistance of some disease resistance genes is only expressed after the rice adult plant stage, and the resistance of most of the resistance genes For a long time, only a few genes such as Xa3, Xa4, Xa7, Xa21 and Xa23 have been used in production
Rice bacterial blight has complex diversity and high variability. After large-scale promotion and planting of disease-resistant varieties carrying a single main effect gene, potentially toxic races will rise to dominant races or new less toxic races will emerge due to pathogen mutation. Species, varieties rapidly lose resistance, which has long plagued breeders and plant pathologists

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ossapk7 protein and its coding gene in improving rice bacterial blight resistance
  • Application of ossapk7 protein and its coding gene in improving rice bacterial blight resistance
  • Application of ossapk7 protein and its coding gene in improving rice bacterial blight resistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1, OsSAPK7 gene expression analysis

[0066] 1. Sow the 9804 rice seeds in a seedling tray filled with sterilized soil, cultivate them in a greenhouse for 25 days, and then transplant them into a net room for single planting.

[0067] 2. During the tillering stage of the rice plants in step 1, the Xoo strain ZHE173 was used to artificially inoculate the rice plants by the leaf cutting method, and each plant was inoculated with 5 leaves.

[0068] 3. Complete the 0, 2, 4, 6, 9, 11, 48, 72, 96 h of manual inoculation in step 2, cut the inoculated leaves, and quickly put them in liquid nitrogen for quick freezing, and take three biological replicates for each sample. All samples were quickly frozen in liquid nitrogen and stored at -70°C.

[0069] 4. Take the sample obtained in step 3, extract the total RNA of the sample, and reverse transcribed it into cDNA.

[0070] 5. Using the cDNA obtained in step 4 as a template, perform a qRT-PCR reaction, use primer F and primer R to ...

Embodiment 2

[0078] Example 2, OsSAPK7 gene function analysis

[0079] 1. Construction of OsSAPK7 gene RNAi vector

[0080] 1. Extract total RNA from 9804 rice leaves and reverse transcribed into cDNA.

[0081] 2. Using the cDNA obtained in step 1 as a template, the primer attB-F and the primer attB-R are used for PCR amplification to obtain the amplified product.

[0082] attB-F: 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCT GGCAGCTGATGGTCACACT-3':

[0083] attB-R: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT AGATGCTCAATGAGATGGTTTT-3'.

[0084] 3. Through the BP reaction, the amplified product obtained in step 2 is introduced into the vector pDONR201 to obtain the positive entry clone plasmid pDONR201-OsSAPK7i (verified by sequencing) containing the double-stranded DNA molecule shown in sequence 3 of the sequence listing.

[0085] BP reaction system: amplified product 2.7μL (50-100ng), vector pDONR2011.0μL (30-50ng), 5×BP Reaction Buffer 1.0μL, BP Enzyme mix 0.3μL.

[0086] BP reaction conditions: 25℃ warm bath for 1h.

[...

Embodiment 3

[0115] Example 3 Application of OsSAPK7 gene in improving rice bacterial blight

[0116] 1. Construction of OsSAPK7 gene overexpression vector

[0117] 1. Extract total RNA from 9804 rice leaves and reverse transcribed into cDNA.

[0118] 2. Using the cDNA obtained in step 1 as a template, the primer attB-F1 and the primer attB-R1 are used for PCR amplification to obtain the amplified product.

[0119] attB-F1: 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCTGC ATGGAGAGGTACGAGCTGCTC-3':

[0120] attB-R1: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT TCAGCTGAGCTGAAACTCACCA-3'.

[0121] 3. Through the BP reaction, the amplified product obtained in step 2 is introduced into the vector pDONR201 to obtain the positive entry cloning plasmid pDONR201-OsSAPK7 containing the double-stranded DNA molecule shown in sequence 1 of the sequence listing.

[0122] BP reaction system: amplified product 2.7μL (50-100ng), vector pDONR201 1.0μL (30-50ng), 5×BPReaction Buffer 1.0μL, BP Enzyme mix 0.3μL.

[0123] BP reaction conditions...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of OsSAPK7 protein and coding genes thereof in improving resistance to bacterial blight of rice. The method for cultivating transgenic rice provided by the invention comprises a step of introducing the genes for coding the OsSAPK7 protein into initial rice so as to obtain transgenic rice which has improved resistance to the bacterial blight. The OsSAPK7 protein is constituted by an amino acid sequence shown as sequence 2 in a sequence list; and gene coding regions for coding the OsSAPK7 protein are shown as the 1st-1080th nucleotide from 5' terminal of sequence 1 in the sequence list. The invention also discloses the application of the OsSAPK7 protein and the coding gene thereof in improving resistance to the bacterial blight of rice. The OsSAPK7 protein and the coding genes thereof provided by the invention have important significance for cultivating a new rice variety of resisting the bacterial blight; and the OsSAPK7 protein and the coding genes thereof are suitable for popularization and application.

Description

Technical field [0001] The present invention relates to an application of OsSAPK7 protein and its coding gene in improving resistance to bacterial blight of rice. Background technique [0002] Bacterial blight, which is caused by Xanthomonas oryzae pv.oryzae (Xoo), is one of the most important bacterial diseases in rice cultivation in the world, and it is seriously harmful in the rice regions of South China and Southeast Asia. Bacterial blight of rice can generally reduce the yield of rice by about 10%, and in severe cases it can reduce the yield by 50%-60%. Utilizing resistance genes and breeding disease-resistant varieties are the most economical and effective measures to control rice bacterial blight. Using methods such as phenotypic identification, genetic analysis, and gene mapping, 40 rice bacterial blight resistance genes have been discovered and reported at home and abroad. However, among the rice bacterial blight resistance genes that have been reported, the resistance...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N9/12C12N15/54C12N15/113A01H5/00A01H6/46
CPCC12N9/1205C12N15/1137C12N15/8218C12N15/8281C12N2310/14
Inventor 周永力张帆卢家铃黎志康
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI