Preparation method of sensitive cell subclone Vero/Slam used for enhancing PPRV replication
A technology of sensitive cells and positive cells, applied in genetically modified cells, botanical equipment and methods, biochemical equipment and methods, etc. The effect of shortening the lesion time, shortening the lesion time, and improving the separation rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] 1. Design and synthesize primers for the complete open reading frame ORF of goat's signal lymphocyte activation molecule Slam. The primers match the P site of the vector and can perform homologous recombination, that is, they have a B site homology arm. The sequence is as follows:
[0039] SEQ ID NO.1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGATCACAAAGGGCTCCTCTCCT,
[0040] SEQ ID NO. 2: GGGGACAACTTTTGTATACAAAGTTGTTCAGCTCTCTGGAACCGTCACA.
[0041] 2. Preparation of Goat Signaling Lymphocyte Activation Molecular RNA Template
[0042] The peripheral blood lymphocytes of healthy goats were collected and isolated, and their total RNA was extracted.
[0043] 3. Preparation of DNA of Goat Signaling Lymphocyte Activation Molecule
[0044] Amplify Slam and establish a 50ul amplification system as follows:
[0045]
[0046] Click and mix the above to carry out RT-PCR amplification. The reaction conditions are:
[0047]
[0048] 4. Slam entry carrier construction
[0049] Gel...
Embodiment 2
[0065] 1-7 steps are with embodiment 1.
[0066] 8. Verification of slam gene expression in Vero / slam cell subclones by indirect immunofluorescence at the protein level
[0067] Inoculate the positive vero / slam cell subclones screened in step 7 in Example 1 into a 6-well cell culture plate with flyers added in advance, after culturing for 48 hours, take out the flyers, and lightly wash the cell surface with PBS buffer (pH7.6) Twice, after draining the liquid, add pre-cooled 80% acetone, place in -20°C refrigerator for fixation for 25 minutes, discard the acetone, and wash the monolayer cells 3 times with PBST buffer (pH 7.6). Block with PBS blocking solution containing 3-5% BSA for 45 min at room temperature. Discard the blocking solution and wash the cells 3 times with PBS. Goat anti-Slam primary antibody (Santa Cruz Biotechnology Co., Ltd.) diluted 1:200 in PBS was added to each well, reacted in a 37°C humid chamber for 1 hour, the primary antibody was discarded, and the m...
Embodiment 3
[0071] 1-7 steps are with embodiment 1.
[0072] 8. Activity analysis of Vero / slam cell subclones expressing slam
[0073] Digest with trypsin, collect vero / slam cells with PBS, lyse the cells, go through 12% SDS-PAGE electrophoresis, transfer to PVDF transfer membrane, wash the membrane with PBS for 3 times, each time for 5min, add 5% skimmed milk powder in PBS dropwise Close overnight. Wash the membrane 3 times with PBST, 5 min each time, add goat anti-slam primary antibody diluted 1:200, and bind at 37°C for 1.5 h. Wash the membrane 3 times with PBS, 10 min each time, add donkey anti-goat enzyme-labeled secondary antibody diluted 1:500, incubate gently at room temperature for 1 h, wash the membrane 3 times with PBST, 5 min each time, wash with tetrachloro-1-naphthol Substrate color development and amino black staining analysis results to check whether the expression product has specific immune activity.
[0074] 9. Results
[0075] After SDS-PAGE electrophoresis, the ex...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More