Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lentiviral vector capable of efficiently expressing mouse gonadotropin-inhibitory hormone genes and application of lentiviral vector

A gonadotropin, lentiviral vector technology, applied in the field of molecular biology, can solve problems such as unreported

Inactive Publication Date: 2017-08-18
HUNAN AGRICULTURAL UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Gonadotropin-inhibiting hormone, as a regulatory factor that inhibits gonadal hormones, has been reported in some species of hormone regulation, but the construction of its lentiviral vector and its role in mouse follicle development have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentiviral vector capable of efficiently expressing mouse gonadotropin-inhibitory hormone genes and application of lentiviral vector
  • Lentiviral vector capable of efficiently expressing mouse gonadotropin-inhibitory hormone genes and application of lentiviral vector
  • Lentiviral vector capable of efficiently expressing mouse gonadotropin-inhibitory hormone genes and application of lentiviral vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Amplification of GnIH in Mouse Ovary Granulosa Cells

[0032] 1. According to the TRIzoL Reagent kit of Invitrogen Company, the RNA of mouse ovarian granulosa cells was extracted (mouse gonadotropin-inhibiting hormone (GnIH), Gene Bank accession number NM021892), and the equipment used was soaked overnight in 0.1% DEPC water, Autoclave. The test tubes used were RNA-free EP tubes. The collected cells were dissolved with Trizol, extracted with chloroform and precipitated with isopropanol, and then RNA was dissolved with 0.1% DEPC water, and the first strand of cDNA was synthesized using this as a template;

[0033] 2. Using the first strand of cDNA synthesized above as a template, carry out PCR amplification with upstream and downstream primers containing BamH I and EcoR I restriction sites, upstream primer: CCGGAATTCATGGAAATTATTTCATTAAAACGATTC (SEQ ID NO: 1), downstream primer: CGCGGATCCCCTATTTTTCTGGTTTCCTTTCTGC ( SEQ ID NO: 2), PCR amplification was performed...

Embodiment 2

[0034] Example 2 Construction of pLV-GnIH lentiviral expression vector

[0035] 1. Enzyme digestion reaction. Reaction system: EcoR I and BamH I double digestion PCR product. EcoR I and BamH I double digestion figure 1 pLVX-IRES-ZsGreen1 shown in A, enzyme digestion system: 10×Buffer 2μL, BamH I 1μL, EcoR I 1μL, pLVX-IRES-ZsGreen1 plasmid 5μL, supplemented with ddH 2 0 to 20 μL. The reaction conditions were 1 h at 37°C, followed by 1% agarose gel electrophoresis ( image 3 ). The digested product was recovered with a DNA purification and recovery kit and stored at -20°C.

[0036]2. Ligation reaction. Reaction system: 10×Buffer 1 μL, linearized pLVX-IRES-ZsGreen1 plasmid 2 μL, GnIH fragment 2 μL, T4 DNA ligase 1 μL, supplemented with ddH 2 0 to 10 μL. The reaction condition was 16°C for overnight ligation to obtain the recombinant pLVX-GnIH-IRES-ZsGreen1 plasmid.

[0037] 3. Transformation and identification of positive clones. The recombinant plasmid was transformed ...

Embodiment 3

[0040] Sequencing verification of positive clones: select positive clones and send them to Nanjing GenScript Biotechnology Co., Ltd. for sequencing. For the sequencing results, see Figure 6 , Blast was used for homology analysis, and the successfully constructed lentiviral plasmid was named pLV-GnIH (pLVX-GnIH was constructed by inserting the GnIH sequence into the pLVX-IRES-ZsGreen1 plasmid). Embodiment 3 lentivirus packaging and titer determination

[0041] 1. Prepare 293FT cells. 293FT cells in logarithmic growth phase were digested with 0.25% trypsin, and the cell density was adjusted to 10 with medium containing 10% serum 7 Each cell was re-seeded in a 10cm cell culture dish, cultured in a 37°C, 5% CO2 incubator, and could be used for transfection when the confluence of the cells reached 70-80%.

[0042] 2. Cell transfection was carried out according to the instructions of the LipofectamineTM 2000 kit.

[0043] 2 hours before transfection, replace with fresh medium. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a lentiviral vector capable of efficiently expressing mouse gonadotropin-inhibitory hormone (abbreviated as GnIH) genes. The lentiviral vector is formed by inserting a GnIH sequence into pLVX-IRES-ZsGreen1 plasmid. The lentiviral vector has the advantages that the lentivirus overexpression plasmid containing the GnIH genes is built, an in-vitro cell level experiment is performed on the lentivirus overexpression plasmid, the experiment result shows that the GnIH lentivirus overexpression plasmid can effectively promote GnIH gene expression after being transferred into cells, and GnIH mRNA expression is increased by more than 1200 times; the overexpressed GnIH can evidently inhibit mouse ovarian granular cell proliferation and lower estrogen secretion level and evidently promote granular cell apoptosis; the built lentiviral vector can be used for preparing preparations for promoting mouse gonadotropin-inhibitory hormone expression.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a lentiviral vector for efficiently mediating the overexpression of gonadotropin-inhibiting hormone genes and an application thereof. Background technique [0002] Gonadotropin-inhibitory hormone (GnIH) is a 12-amino acid arginyl-phenylalanamide (RF amide) neuropeptide discovered by Tsutsui and colleagues in the hypothalamus of the Japanese quail in 2000. The acting receptor is a G protein-coupled receptor 147 (GPR147). GnIH can inhibit the synthesis and release of gonadal hormones to regulate animal reproduction, so it is named gonadotropin-inhibiting hormone. Since then, GnIH and its homologues have been discovered in various animals, and they are called RF amide-related peptides (RFRPs) because they all have a characteristic C-terminal amino acid sequence LPXRF (X=L or P). The discovery of GnIH proves that gonadotropin inhibitory hormone (GnRH) is not the only neurop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C07K7/23
CPCC07K7/23C12N15/86C12N2740/15043
Inventor 王水莲曾杰龚金秋阳美霞唐姣美
Owner HUNAN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com