Unlock instant, AI-driven research and patent intelligence for your innovation.

Rhizopus oryzae LJH3 and applications of Rhizopus oryzae LJH3 in preparation of genistein through biotransformation of sophoricoside

A technology of Rhizopus oryzae and Sophora glucoside, which is applied in the field of biotransformation to prepare genistein, can solve the problems of easily damaged parent nucleus structure, low concentration of substrate feeding, difficult industrial application and the like, and achieves low production cost, low substrate The effect of high feeding concentration and low environmental pollution

Active Publication Date: 2017-09-22
ZHEJIANG UNIV OF TECH
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, existing enzymatic conversion research reports, such as the hydrolysis process of soybean isoflavones hydrolyzed by β-glucosidase, when the concentration of soybean isoflavones is 0.5mmol / L, the hydrolysis rate of genistein can reach 94.2% (Zhang Yongzhong, Li Muzi, Sun Yanmei, et al. "Amano" β-glucosidase hydrolysis technology of soybean isoflavones. Food Science, 2008,29(5):254-258.), but this method uses commercial grade β-glucosidase produced in Japan , the cost is undoubtedly high, and the concentration of the substrate is low, so there are certain difficulties in industrial application; if the acid hydrolysis method is used, the structure of the parent nucleus is easily destroyed, and more by-products are produced, resulting in low product yields. Separation and purification Difficulty and other issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rhizopus oryzae LJH3 and applications of Rhizopus oryzae LJH3 in preparation of genistein through biotransformation of sophoricoside
  • Rhizopus oryzae LJH3 and applications of Rhizopus oryzae LJH3 in preparation of genistein through biotransformation of sophoricoside
  • Rhizopus oryzae LJH3 and applications of Rhizopus oryzae LJH3 in preparation of genistein through biotransformation of sophoricoside

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Isolation and screening of embodiment 1 transformed strain

[0028] Crush the Chinese medicinal material Huaijiao through a 60-mesh sieve, put 10g of Huaijiao powder in a conical flask, add a small amount of sterile water to moisten it, and incubate at a constant temperature of 28°C for 4 days, then add 90mL of sterile water to make a suspension, dilute 1×10 6 Spread on potato dextrose agar plate medium (PDA) after doubling, culture at 28°C for 4 days, pick fungal colonies with different colors and shapes and transfer to fresh PDA plate medium, place at 28°C for 3 days to obtain spores Ten abundant strains (see Table 1 for strain numbers) were stored in a 4°C refrigerator for later use.

[0029] Pick 2 rings of spores from the plate culture medium of each of the above-mentioned strains, inoculate into 100mL initial fermentation medium (250mL Erlenmeyer bottle), shake culture at 30°C and 200r / min for 5 days, and add 1mg of sophorin Dissolve in 1 mL, 0.1 mol / L NaOH aqueo...

Embodiment 2

[0040] Example 2: Stability Verification of Transformation of Bacterial Strain LJH3

[0041] Using the strain LJH3 as the transformed strain, the fermentation broth was prepared in a 100mL shake flask fermentation scale, and the fermentation broth containing the bacteria was used to transform sophoricroside to verify the transformation stability of the strain. The specific process steps are as follows:

[0042] (1) Inoculate the bacterial strain LJH3 plate bacterial classification preserved in 4 ℃ of refrigerators on fresh PDA plate culture medium, plate is cultivated at 30 ℃ constant temperature 2d, and described PDA plate medium composition and preparation method are the same as embodiment 1;

[0043] (2) Use an inoculation loop to pick up the step (1) After the activation culture, the spores of the strain LJH3 were inoculated twice into 100 mL of the initial fermentation medium, and cultured for 5 days at 30 ° C and 200 r / min constant temperature shaking conditions to obtain...

Embodiment 3

[0046] Example 3: Classification and Identification of Bacterial Strain LJH3

[0047] The LJH3 strain was inoculated on potato agar plate medium and cultured in an incubator at 30°C for 3 days. The colonies were dense, white at first, and then turned grayish brown or dark brown. Shaped or root-like, brown; cyst peduncles erect or slightly curved, opposite to rhizoids, sometimes enlarged or branched, brown; cyst axis spherical or subspherical or oval, light brown.

[0048] The strain LJH3 was submitted to Sangon Bioengineering (Shanghai) Co., Ltd. for 18S rDNA sequencing, and the measured sequence size was 600bp. The specific sequence (shown in SEQ ID NO: 1) is as follows:

[0049] CGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGCACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses Rhizopus oryzae LJH3 and applications of the Rhizopus oryzae LJH3 in preparation of genistein through biotransformation of sophoricoside. According to the present invention, the applications comprise that a fermentation broth obtained by carrying out fermentation culture on Rhizopus oryzae LJH3, or the mixed liquid of a filtrate obtained by filtering out bacteria from the fermentation broth and an equal volume of distilled water is used as a biological catalyst and sophoricoside is used as a substrate to form a transformation system, a transformation reaction is performed at a temperature of 30-38 DEG C under a 200-250 r / min constant temperature oscillation condition, and the transformation liquid is separated and purified to obtain the genistein after the transformation reaction is completed; the transformation yield of the genistein is 84.2% and the purity is 92.5% when the substrate feeding concentration is 1 g / L; and the low-activity sophoricoside is transformed into the good activity genistein through the method, and the method is the optional genistein production method, and has advantages of low production cost, high transformation rate, low environmental pollution, and the like.

Description

(1) Technical field [0001] The invention relates to a method for preparing genistein through biotransformation of sophorin as raw material. (2) Background technology [0002] Genistein (genistein) is also known as genistein, genistein and genistein, etc., the chemical name is 5,7,4′-trihydroxy isoflavone (CAS number is 446-72-0, molecular formula is C 15 h 10 o 55 , with a molecular weight of 270.24), belonging to isoflavones. Genistein has estrogen-like effects, and has anti-inflammatory, anti-fertility and osteoporosis prevention effects. In recent years, many scholars have studied the biological activity of genistein and found that it also has anti-oxidation, hypolipidemic , anti-tumor and prevention of osteoporosis and other biological activities. [0003] Genistein exists in some leguminous plants in a free state, such as Sophora japonica, soybean, pueraria, bean root and gorse, so it can be isolated from these plants, but its content is relatively low, such as Soph...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/14C12P17/06C12R1/845
CPCC12N1/14C12P17/06C12N1/145C12R2001/845
Inventor 梅建凤刘姜华应国清易喻陈建澍张彦璐
Owner ZHEJIANG UNIV OF TECH