Rhizopus oryzae LJH3 and applications of Rhizopus oryzae LJH3 in preparation of genistein through biotransformation of sophoricoside
A technology of Rhizopus oryzae and Sophora glucoside, which is applied in the field of biotransformation to prepare genistein, can solve the problems of easily damaged parent nucleus structure, low concentration of substrate feeding, difficult industrial application and the like, and achieves low production cost, low substrate  The effect of high feeding concentration and low environmental pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Isolation and screening of embodiment 1 transformed strain
[0028] Crush the Chinese medicinal material Huaijiao through a 60-mesh sieve, put 10g of Huaijiao powder in a conical flask, add a small amount of sterile water to moisten it, and incubate at a constant temperature of 28°C for 4 days, then add 90mL of sterile water to make a suspension, dilute 1×10 6 Spread on potato dextrose agar plate medium (PDA) after doubling, culture at 28°C for 4 days, pick fungal colonies with different colors and shapes and transfer to fresh PDA plate medium, place at 28°C for 3 days to obtain spores Ten abundant strains (see Table 1 for strain numbers) were stored in a 4°C refrigerator for later use.
[0029] Pick 2 rings of spores from the plate culture medium of each of the above-mentioned strains, inoculate into 100mL initial fermentation medium (250mL Erlenmeyer bottle), shake culture at 30°C and 200r / min for 5 days, and add 1mg of sophorin Dissolve in 1 mL, 0.1 mol / L NaOH aqueo...
Embodiment 2
[0040] Example 2: Stability Verification of Transformation of Bacterial Strain LJH3
[0041] Using the strain LJH3 as the transformed strain, the fermentation broth was prepared in a 100mL shake flask fermentation scale, and the fermentation broth containing the bacteria was used to transform sophoricroside to verify the transformation stability of the strain. The specific process steps are as follows:
[0042] (1) Inoculate the bacterial strain LJH3 plate bacterial classification preserved in 4 ℃ of refrigerators on fresh PDA plate culture medium, plate is cultivated at 30 ℃ constant temperature 2d, and described PDA plate medium composition and preparation method are the same as embodiment 1;
[0043] (2) Use an inoculation loop to pick up the step (1) After the activation culture, the spores of the strain LJH3 were inoculated twice into 100 mL of the initial fermentation medium, and cultured for 5 days at 30 ° C and 200 r / min constant temperature shaking conditions to obtain...
Embodiment 3
[0046] Example 3: Classification and Identification of Bacterial Strain LJH3
[0047] The LJH3 strain was inoculated on potato agar plate medium and cultured in an incubator at 30°C for 3 days. The colonies were dense, white at first, and then turned grayish brown or dark brown. Shaped or root-like, brown; cyst peduncles erect or slightly curved, opposite to rhizoids, sometimes enlarged or branched, brown; cyst axis spherical or subspherical or oval, light brown.
[0048] The strain LJH3 was submitted to Sangon Bioengineering (Shanghai) Co., Ltd. for 18S rDNA sequencing, and the measured sequence size was 600bp. The specific sequence (shown in SEQ ID NO: 1) is as follows:
[0049] CGGAAGGATCATTAATTATGTTAAAGCGCCTTACCTCTTAGGGTTTCCTCTGGGGTAAGTGATTGCTTCTACACTGTGAAAATTTGGCTGAGAGACTCAGACTGGTCATGGGTAGACCTATCTGGGGTTTGATCGATGCCACTCCTGGTTTCAGGAGCACCCTTCATAATAAACCTAGAAATTCAGTATTATAAAGTTTAATAAAAAACAACTTTTAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGAATCATC...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



