Sinonovacula constricta C1q (Complement 1q) gene, encoded protein, cloning method of sinonovacula constricta C1q gene and recombinant sinonovacula constricta C1q gene engineering bacterium construction method

A technology of genetically engineered bacteria and encoded protein, applied in the field of encoded protein and its cloning, C1q gene of razor clam, and recombinant C1q genetically engineered bacteria of razor razor, which can solve the problems of decreased immune defense ability of razor razor, failure of antibiotics, drug resistance of bacteria, etc. problems, to achieve high-efficiency binding activity and agglutination activity, increase binding ability, and enhance immunity

Active Publication Date: 2017-10-20
NINGBO UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

According to reports, bacterial diseases are one of the main factors affecting the death of razor clams in recent years, especially because the diseases caused by Vibrio are relatively serious, which can easily infect razor clam individuals, resulting in the decline of the immune defense ability of razor clam constrictor individuals
The current prevention and control methods mainly use antibiotics and chemical drugs, but the long-term use of antibiotics and chemical drugs induces drug resistance of bacteria, leading to the failure of antibiotics, and will also have a certain impact on the breeding environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sinonovacula constricta C1q (Complement 1q) gene, encoded protein, cloning method of sinonovacula constricta C1q gene and recombinant sinonovacula constricta C1q gene engineering bacterium construction method
  • Sinonovacula constricta C1q (Complement 1q) gene, encoded protein, cloning method of sinonovacula constricta C1q gene and recombinant sinonovacula constricta C1q gene engineering bacterium construction method
  • Sinonovacula constricta C1q (Complement 1q) gene, encoded protein, cloning method of sinonovacula constricta C1q gene and recombinant sinonovacula constricta C1q gene engineering bacterium construction method

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0057] C1q gene cloning and sequence analysis

[0058] (1) Through the previous EST (Expressed Sequence Tag) analysis of the cDNA library of Vibrio parahaemolyticus-induced C1q, multiple EST sequences encoding the C1q gene were found, and the sequencing analysis of one of the EST clones showed that the clone encoded C1q of C1q partial fragments;

[0059] (2) RACE primer design: 3' RACE nested primers were designed according to the EST clone encoding the C1q partial fragment of razor clam constriction: 3' upstream specific primer 1: TGTGAACGACAGTAGTGACAGCAAA, 3' upstream specific primer 2: ATGGGCACAGAATGACCAACTAGAC, to amplify the 3' adapter Primer Adaptor3: GGCCACGCGTCGACTAGTACTT;

[0060](3) Razor clam C1q (3) RACE amplification to obtain the full-length sequence of the C1q gene, the specific steps are as follows:

[0061] a. Extraction of total RNA: Take the gills and hepatopancreas tissues (0.2g-1g) of razor clam constricta into a 1.5ml RNA free centrifuge tube, add 1.0 ...

specific Embodiment 2

[0065] Full-length cloning of C1q gene and construction and expression of recombinant protein

[0066] a. Total RNA extraction: Take each part of the razor clam (0.2g-1g) into a 1.5ml RNA free centrifuge tube, add 1.0 mL of Trizol reagent (purchased from Takara Company), and fully homogenize with a homogenizer. Centrifuge at 12000 g at 4 °C for 5 min, take the supernatant, add 0.2 mL of chloroform, shake and mix, let stand at room temperature for 5 min, centrifuge at 12000 g at 4 °C for 15 min, draw the supernatant into a centrifuge tube, add the Add an equal volume of isopropanol to the supernatant, mix well, let stand at room temperature for 5 minutes, centrifuge at 12,000 rpm for 5 minutes at 4°C, remove the supernatant, add 1 mL of ethanol with a mass percentage concentration of 75% to the precipitate, and place at 4°C , 12,000 rpm, centrifuge for 5 min, discard the supernatant, add 1 mL of 75% ethanol to the pellet to resuspend the pellet, 4°C, 12,000 rpm, centrifuge for...

specific Embodiment 3

[0073] Purification of recombinant proteins

[0074] a. Bacterial cell lysis: resuspend 100 mL of bacterial sediment with 10 mL of lysis buffer (imidazole concentration: 5 mM), add 1 mg / ml lysozyme, incubate on ice for 30 min, and sonicate the bacterial cell (sonication for 5 s, Stop for 10s, 6 times in total, power 30w, 10000g, 4°C, centrifuge for 20min, collect the supernatant;

[0075] b. Protein purification: draw 1 mL Ni-NTA Sefinose TM Put Resin on the column, wash twice with sterile water, and then equilibrate once with lysis buffer (containing imidazole concentration 5mM); mix the supernatant obtained in step (a) with the Ni-NTASefinose that was previously treated on the column TM Resin mixed, mixed at 4°C for 2 h, collected effluent, eluted twice with wash buffer (imidazole concentration 40mM), 10mL each time, collected effluent respectively, added 1.25 mL elution buffer (imidazole concentration 250mM), eluted 2 times, the effluent was collected separately. Take ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a sinonovacula constricta C1q (Complement 1q) gene, an encoded protein, a cloning method of the sinonovacula constricta C1q gene and a recombinant sinonovacula constricta C1q gene engineering bacterium construction method. The sinonovacula constricta C1q gene, the encoded protein, the cloning method of the sinonovacula constricta C1q gene and the recombinant sinonovacula constricta C1q gene engineering bacterium construction method are characterized in that a sequence of the sinonovacula constricta C1q gene is as shown in SEQ ID NO.1; the cloning method of the sinonovacula constricta C1q gene comprises the steps of designing nested primers of 3'RACE according to an EST (expression sequence tag) sequence homologous with the C1q gene and amplifying a full gene length by adopting a 3'RACE technology; an amino acid sequence of the encoded protein of the sinonovacula constricta C1q gene is as shown in SEQ ID NO.2, and a sinonovacula constricta C1q protein is amplified by a primer respectively containing a BamH I site and an Xho I site; a target gene obtained by cloning is inserted into a vector to obtain a recombinant plasmid, and the recombinant plasmid is subjected to inducible expression and then is purified to obtain a gene engineering bacterium. The sinonovacula constricta C1q gene has the advantages of combining capacity for lipopolysaccharide, peptidoglycan and mannan and obvious agglutination effects for escherichia coli, vibrio anguillarum and vibrio parahaemolyticus.

Description

technical field [0001] The invention belongs to the fields of molecular biology and genetic engineering, and in particular relates to a clam clam C1q gene, a coded protein and a cloning method thereof, and a method for constructing a recombinant clam clam C1q genetically engineered bacterium. Background technique [0002] C1q (Complement 1q) is a target recognition protein of the classical complement pathway. As an important recognition molecule and able to initiate the classical complement pathway, it is the main link between the innate and adaptive immune systems. In addition to being a key component of the classical complement pathway, C1q is also involved in several other immune processes, including maintenance of immune tolerance by clearance of apoptosis, bacterial phagocytosis, neutralization of retroviruses, cell adhesion and dendritic cell , regulation of B cells and fibroblasts. Studies have found that many non-complement proteins also contain the C1q globular dom...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/10C07K14/435C12N15/70C12N1/21G01N33/68C12R1/19
CPCC07K14/43509C12N15/70G01N33/68
Inventor李成华崔毅张卫卫赵雪琳邵铱娜
OwnerNINGBO UNIV